L’esclave occulté – La Vie des idées

Au livre VI (6.137), Hérodote raconte comment les Athéniens ont pour la première fois réduit des hommes en esclavage lorsque leurs filles furent violées par les Pélasges alors qu’elles allaient chercher de l’eau à la source ; cette tâche devenue dangereuse fut dès lors confiée à des populations réduites à cet effet en servitude. Or on apprend au livre VIII (8.44) que les Pélasges ne sont autres que les ancêtres des Athéniens. « C’est – dit P. Ismard – que les Pélasges sont des opérateurs d’altérité temporelle. Par leur intermédiaire, les Grecs pensent l’altérité de leur passé, la façon dont ils en proviennent et s’en sont arrachés » (p. 80).

 

 

Source : L’esclave occulté – La Vie des idées

 

 

Recension Philosophie

L’esclave occulté

À propos de : Paulin Ismard, Le Miroir d’Œdipe. Penser l’esclavage, Seuil


par René de Nicolay , le 31 janvier

Télécharger l’article : PDF

Peu d’auteurs dans l’Antiquité avaient un discours sur l’esclavage, mais beaucoup en parlaient tout de même, parfois entre les lignes ou par des voies détournées, afin de le critiquer ou de le justifier.

Dans la lignée de deux études précédentes (La Démocratie contre les experts, 2015 La Cité et ses esclaves, 2019), le nouvel ouvrage de Paulin Ismard, Le Miroir d’Œdipe. Penser l’esclavage, entreprend de cerner la place paradoxale des esclaves dans la cité antique, en particulier à Athènes.

Le paradoxe est le suivant : à Athènes, les esclaves sont partout et nulle part à la fois. L’archéologie et maints passages des sources littéraires nous prouvent que les esclaves étaient omniprésents dans l’ordre de la production athénienne, au moins depuis la fin de la période archaïque : les activités agricoles, artisanales, minières de la cité reposaient sur eux. Mais aucun ouvrage antique qui nous soit parvenu ne prend les esclaves pour thème.

Faut-il conclure, dès lors, que les esclaves étaient absents du discours Le Miroir d’Œdipe montre en quoi une telle conclusion serait hâtive. Un discours antique sur l’esclavage existe, dans les marges des grands genres (philosophie, théâtre, histoire). Les esclaves antiques justifieraient ainsi l’inversion du mot d’Héraclite (DK B34) : absents, ils sont présents. Absents parce qu’il ne peut exister pour eux de communauté avec les hommes libres, les esclaves sont présents dans la mesure où c’est leur relégation aux marges qui fait tenir la société antique. « L’impossibilité d’inscrire la présence [des esclaves] dans le monde commun était la forme même de leur présence en son sein » (p. 18). C’est à l’étude de cette présence marginale que se consacre l’ouvrage.

Une « anthropologie de l’implicite »

L’auteur part de l’analyse marxiste proposée jadis par Moses Finley : si les esclaves sont présents en tout point de l’infrastructure de la cité antique et radicalement absents de la superstructure, c’est que l’esclavage n’avait pas à être défendu en termes idéologiques. Il reposait en effet sur la domination violente, comme le montre l’expérience de pensée proposée par Socrate au livre IX de la République de Platon, où un maître transporté avec ses esclaves dans un désert et privé de l’usage de la force doit flatter ses esclaves pour survivre. À Athènes et en Grèce plus largement, la violence instituée rendait superflue l’articulation d’une justification chargée d’assurer le consentement des dominés.

La formule originale de Finley est toutefois prudente : dans la cité grecque de l’époque classique, écrit l’historien britannique dans Démocratie antique et démocratie moderne, « il y avait peu de place pour l’idéologie au sens marxiste ». Or la marge ainsi laissée (« peu ») légitime les tentatives d’identifier en Grèce classique des justifications idéologiques de l’esclavage, par exemple chez Aristote. Paulin Ismard n’évoque malheureusement pas le débat qui opposa à ce sujet Charles Kahn et Malcolm Schofield [1]. Alors que le second refusait de considérer la théorie aristotélicienne de l’esclavage comme idéologique, au motif qu’elle est formulée sur la base d’arguments rationnels, Charles Kahn répondait que la faiblesse des arguments d’Aristote invitait à les interpréter comme une idéologie.

Quoi qu’il en soit d’Aristote, la rareté des sources offrant une discussion pro et contra de l’esclavage semble donner raison à Finley. P. Ismard propose dès lors de faire un pas de plus que l’historien anglais. Prenant acte de ce que la pensée des intellectuels antiques au sujet de l’esclavage est mince, il s’intéresse à leur pensée de l’esclavage, qui « se déploie le plus souvent entre les lignes ou dans la marge des textes les mieux connus, dans leur impensé ou à leur insu » (p. 14).

Pour mettre en lumière ce fait, P. Ismard suit la direction indiquée par Nicole Loraux, qui critiquait « l’anthropologie de l’explicite » et sa prédilection pour l’étude des pratiques ritualisées par lesquelles la cité antique organise son image. Une telle approche cède aux sirènes de la belle forme projetée par la cité ; une « anthropologie de l’implicite » (la formule est de P. Ismard, p. 18) est attentive à ce sur quoi les textes ne placent pas leur focale.

Trois éléments de l’ouvrage apparaissent donc centraux et méritent qu’on s’y arrête. Il y a, d’abord, la présence de l’esclavage au cœur des valeurs fondatrices de la cité, dont nous Modernes avons hérité. Il y a, ensuite, l’approche adoptée par P. Ismard pour expliciter cet implicite, celle des « entrelectures ». Il y a, enfin, l’interprétation psychanalytique, contestable, que l’auteur propose pour rendre compte de cette relégation.

L’homme libre, l’autre de l’esclave

Le premier apport de l’ouvrage se dégage dès le premier chapitre, consacré à une discussion de la liberté chez Platon et Aristote. Chez ces philosophes, l’homme libre se définit comme le contraire de l’esclave : il fait ce que ne fait pas l’esclave (contempler chez Platon, contempler et participer à la vie de la cité chez Aristote) ; il ne fait pas ce que fait l’esclave (travailler). L’homme libre est même dépendant de l’esclave pour exercer les activités les plus pleinement libérales. Ainsi, chez Aristote, la contemplation comme la politique justifient-elles que le maître du domaine confie à un intendant esclave l’administration de ses biens. L’esclave est donc à la fois le contour de l’homme libre et sa condition de possibilité.

L’auteur ne s’attarde pas, toutefois, sur une différence majeure entre Platon et Aristote : chez le premier (en tout cas dans le Théétète) l’activité politique est servile, ce qu’elle n’est pas chez le second. Il n’évoque pas non plus une dimension fondamentale de la présence de l’esclavage à Athènes, le rejet de toute forme de subordination comme une marque de servitude, relevé par Platon comme Aristote dans leurs analyses de la démocratie (Rep. 8.563d7-e1 Pol. 5.9 et 6.2).

Mais cette présence de l’esclavage au cœur de la définition de l’homme libre justifie, selon Paulin Ismard, une prise de recul vis-à-vis du « rapport que nous entretenons avec l’Antiquité classique » et des « rapports de domination dont nous héritons à travers elle, tant il est vrai que nous imaginons la cité classique spontanément, presque malgré nous, depuis la position des citoyens et des maîtres » (p. 163). Il y a, bien sûr, ce qu’on pourrait appeler le despoto-centrisme spontané avec lequel nous lisons les textes anciens. Mais il y a aussi, comme P. Ismard le montre dans son étude de la liberté athénienne, le risque d’être aveugle aux rapports qu’entretient le concept grec de liberté – dont nous sommes à maints égards les héritiers – avec l’esclavage. Chez Platon et Aristote, la liberté est tantôt définie comme ce dont l’esclave est privé, tantôt comme ce que permet le travail servile. Dans le discours démocratique athénien rapporté par les philosophes, par ailleurs, toute forme de sujétion est présentée comme une honteuse servitude. En appelant notre attention sur cette présence de l’esclavage au cœur de la liberté et de la démocratie athéniennes, l’essai de Paulin Ismard nous invite à nous prendre pour objets d’une « anthropologie de l’implicite ».

« Entrelectures » de l’esclavage

Si l’esclavage n’est présent dans le discours antique (et particulièrement athénien) qu’à la marge, P. Ismard choisit de le mettre en lumière grâce à l’éclairage d’autres textes où il occupe la même position liminaire. L’analogie fait alors œuvre de mise en valeur. P. Ismard s’engage donc dans des « entrelectures », fondées sur l’idée que « deux textes de fiction éloignés dans le temps ou l’espace ont le pouvoir de s’entrelire, c’est-à-dire de s’interpréter mutuellement, bien souvent à leur insu, et cela quel que soit l’ordre de succession qui est le leur » (p. 47).

P. Ismard utilise ainsi le roman Absalon, Absalon de W. Faulkner pour jeter une lumière neuve sur l’Œdipe-roi de Sophocle, dans le chapitre deux qui donne son titre à l’ouvrage entier. L’auteur montre que, chez Faulkner comme chez Sophocle, « les esclaves sont placés en position spéculaire. Ils rendent possible l’existence d’un monde qui est devenu illisible et incompréhensible à ceux qui l’habitent, et sont en quelque sorte les détenteurs de son énigme » (p. 50).

La pratique des entrelectures peut s’avérer cependant moins éclairante parfois, comme en témoigne le chapitre 4 consacré à la relation, par Diodore, de la révolte des esclaves de Sicile en 135 av. J.-C. Dans ses pages aussi fascinantes que stimulantes, P. Ismard dresse des analogies entre le mime que fait donner dans sa capitale d’Enna le roi Eunous, syrien et ex-esclave, afin de représenter la révolte des esclaves contre leurs maîtres, et le « théâtre documentaire » inventé au début des années 1920 par Erwin Piscator, dont le but était de « montrer la réalité des rapports sociaux » (p. 106). Mais l’auteur ne met pas pleinement en lumière les liens qu’il dresse entre les événements racontés par Diodore et l’œuvre de Piscator. Les premiers « instauraient (…) un temps de suspens » (p. 98) dans leur révolte, pour tenter d’en prendre conscience et de mieux la comprendre. Piscator, lui, visait « l’intervention active dans le cours des événements » (p. 106). La finalité paraît différente, sans parler de la différence de contexte : une élaboration de l’analogie aurait sans doute donné plus de clarté à cette entrelecture.
L’esclavage, un refoulé des sociétés antiques ?

Non seulement la cité est tenue, selon P. Ismard, par des êtres qu’elle exclut de son discours explicite ; elle organiserait même « consciemment » (p. 20) cette relégation. L’interprétation paraît cependant détachable de la thèse elle-même : il est possible d’affirmer, d’une part, que la cité antique tient par ses marges, mais ne parle que de son plein, sans soutenir, de l’autre, que son économie psychique exige cette relégation. Pourtant, P. Ismard insiste pour étayer cette interprétation psychologique dans plusieurs de ses chapitres, comme dans sa conclusion.

L’écart entre la thèse et son interprétation psychanalytique se lit dès le premier chapitre du livre. P. Ismard se
fonde sur la digression du Théétète de Platon, où Socrate revendique pour le philosophe le sort de Thalès, tombé dans un puits à force de contempler les étoiles, suscitant l’hilarité d’une esclave thrace plus au fait des réalités immédiates (174a). Pour Socrate, le philosophe ne peut que détourner son attention du monde social et politique, qui l’empêche de contempler. Il la détourne tant et si bien qu’il n’est même pas au fait de son ignorance : « tout cela, il ne sait même pas qu’il ne le sait pas » (173e).

P. Ismard en conclut que, « pour être pleinement philosophe, il ne suffit pas d’ignorer le fonctionnement de la vie civique ; il convient d’ignorer cette ignorance » (p. 28). Cette nécessité est, selon lui, celle de la Verleugnung (dénégation) freudienne « par laquelle le sujet se protège en désavouant ce qui le menace » (ibid.). La menace est ici celle de la politique elle-même : l’activité politique, comme toute forme de travail pour autrui, est à Athènes entachée du soupçon d’esclavage.

Cette interprétation est-elle appelée par le texte ? Cela n’est pas certain. Dans le débat entre M. Schofield et C. Kahn, c’était la faiblesse des arguments proposés par Aristote qui permettait de dire qu’ils exprimaient une idéologie ; c’est sur ce critère que ceux de Socrate doivent être évalués pour décider s’ils ne se comprennent bien que comme expression d’un impératif psychologique. Or l’argumentation de Socrate n’a pas besoin de cette réduction pour être comprise : si le but de l’existence est « l’assimilation au dieu autant qu’il est possible » (176a), alors le philosophe fait bien de se tenir éloigné du tribunal et de ses contraintes [2].

Les mêmes doutes sur l’interprétation psychanalytique proposée naissent à la lecture du troisième chapitre, consacré aux récits athéniens sur la naissance de l’esclavage et à la place qu’ils délimitent pour l’esclave. Pour les Athéniens, l’esclave n’est pas cet autre avec lequel on échange les biens ou qui permet l’exogamie : « l’esclavage est la négation de toute figure du lien. Son institution définit une altérité sans visage et sans nom » (p. 84). P. Ismard rapproche cette altérité de ce que produit la forclusion lacanienne [3], traduction interprétative de la Verwerfung freudienne : « l’existence de cet autre est refusée si radicalement qu’elle ne se traduit par aucune mise en récit » (p. 85).

La force de l’interprétation proposée par P. Ismard paraît reposer sur sa lecture de deux passages d’Hérodote, où le récit mentionne certes des esclaves, mais sans jamais en faire des personnages centraux, ni même actifs. Au livre VI (6.137), Hérodote raconte comment les Athéniens ont pour la première fois réduit des hommes en esclavage lorsque leurs filles furent violées par les Pélasges alors qu’elles allaient chercher de l’eau à la source ; cette tâche devenue dangereuse fut dès lors confiée à des populations réduites à cet effet en servitude. Or on apprend au livre VIII (8.44) que les Pélasges ne sont autres que les ancêtres des Athéniens. « C’est – dit P. Ismard – que les Pélasges sont des opérateurs d’altérité temporelle. Par leur intermédiaire, les Grecs pensent l’altérité de leur passé, la façon dont ils en proviennent et s’en sont arrachés » (p. 80).

Mais qu’est-ce qui, dans ces deux passages, justifie une interprétation en termes de « forclusion » ? Elle serait appelée si, par exemple, les Pélasges eux-mêmes avaient été asservis, les Athéniens ne pouvant alors admettre descendre d’esclaves. Néanmoins Hérodote est explicite : les premiers esclaves des Athéniens furent autres que les Pélasges. Rien ne paraît donc nécessiter, pour les Athéniens, un refoulement de l’origine de l’esclavage.

Une autre voie possible : Aristote

Les doutes que laissent les chapitres sur l’interprétation psychanalytique proposée reparaissent à la lecture de la conclusion. Pour l’auteur, la cité antique s’est construite en reléguant l’esclave dans le domaine de « l’insu ». Cette relégation a deux fonctions : d’abord, ôter à l’esclave son « pouvoir de subversion au regard des institutions traditionnelles de la communauté », pouvoir qui aurait été libéré par une thématisation explicite de l’esclavage (p. 160) ; par ailleurs, soulager la cité de « l’angoisse » qui serait née de « l’incorporation réciproque » et de l’indistinction entre maître et esclave (p. 161).

Ces deux fonctions, toutefois, pouvaient être remplies sans refoulement. La première pouvait l’être par l’idéologie ; et la seconde, par une définition de l’homme libre qui se passe d’une référence à l’esclave. Aristote montre la voie, qui propose à la fois une justification de l’esclavage (au livre 1 des Politiques) et une définition de la personne libre comme celle qui vit pour elle-même, et non pour autrui (Rhet. 1367a33, Met. 982b4-26).
La figure d’Aristote vient donc tempérer les trois conclusions de l’ouvrage. Il est possible de définir l’homme libre par lui-même, sans en faire avant tout un non-esclave. Certes, les conditions de possibilité d’une vie pleinement libre, faite de contemplation et d’activité politique, comprennent l’esclavage ; mais il s’agit ici d’une question de degrés, non de nature : l’esclave permet une vie plus libre ; il ne définit pas la vie libre.

En outre, la justification aristotélicienne de l’esclavage – idéologique ou non – montre que l’esclavage n’existait pas que dans les marges : elle prend même place dans un débat qui précède Aristote, comme il le reconnaît.
Ces deux remarques en amènent une troisième : Aristote montre que le refoulement de l’esclavage n’était pas nécessaire à la cité antique.

Aristote suffit-il à invalider les conclusions de l’ouvrage ? Certainement pas. Outre la richesse des lectures proposées, l’ouvrage vaut par ces thèses, qui entendent s’appliquer aux tendances que Paulin Ismard voit à l’œuvre dans la cité antique. Une exception ne saurait par elle seule mettre en cause l’existence d’une tendance. Reste qu’une confrontation plus directe avec l’option aristotélicienne aurait permis de mesurer plus précisément la portée des conclusions d’un ouvrage qui profitera à ses lecteurs, spécialistes ou non.

Paulin Ismard, Le Miroir d’Œdipe. Penser l’esclavage, Paris, Seuil, 2023, 224 p., 23 euros.

par René de Nicolay, le 31 janvier

 

 

 

 

 

 

Scandale Nestlé : quelles différences entre eau minérale et eau du robinet ? – L’Express

 

Selon une enquête publiée par le Monde et Radio France, au moins "un tiers des marques françaises d’eau de source et d’eau minérale" utilisent des traitements interdits par ma réglementation.

Selon une enquête publiée par le Monde et Radio France, au moins « un tiers des marques françaises d’eau de source et d’eau minérale » utilisent des traitements interdits par la réglementation.

dpa Picture-Alliance via AFP

D’après l’enquête du Monde et de Radio France, le ministère de l’Industrie, alerté par la répression des fraudes, a reçu dès 2021 les représentants de Nestlé Waters, qui ont reconnu leur recours à des traitements d’ultraviolets et de filtres au charbon actif sur certaines eaux minérales afin de maintenir « leur sécurité alimentaire ». Le gouvernement, qui aurait alors dû informer la Commission européenne, « a tenté de gérer la crise avec la plus grande discrétion », révèle Le Monde.

Un rapport de l’Inspection générale des affaires sociales, que les deux médias ont pu consulter, a par ailleurs été « soumis à un secret quasi-absolu » par l’exécutif. Pour cause, ce rapport estime que 30 % des marques françaises ont recours à des traitements non conformes. « La mission n’a pas de doute sur le fait que la proportion de 30 % [des dénominations commerciales concernées] sous-estime le phénomène et que l’ensemble des minéraliers soient concernés », rapporte le quotidien.

Source : Scandale Nestlé : quelles différences entre eau minérale et eau du robinet ? – L’Express

 

Scandale Nestlé : quelles différences entre eau minérale et eau du robinet ?

Santé. Une enquête publiée par Le Monde et Radio France révèle que de grands producteurs d’eau minérale et d’eau de source ont procédé à des traitements non conformes à la réglementation.

Par Chloé Sémat
Publié le
Selon une enquête publiée par le Monde et Radio France, au moins "un tiers des marques françaises d’eau de source et d’eau minérale" utilisent des traitements interdits par ma réglementation.

Selon une enquête publiée par le Monde et Radio France, au moins « un tiers des marques françaises d’eau de source et d’eau minérale » utilisent des traitements interdits par la réglementation.

dpa Picture-Alliance via AFP

Une marque, un emballage, une étiquette colorée… Autant de caractéristiques bien connues des eaux minérales qui font leur renommée chez les clients, en France comme à l’étranger. Et pourtant, selon une enquête conduite par la cellule investigation de Radio France et Le Monde dévoilée aujourd’hui, certains des plus grands noms d’eau en bouteille ont reçu depuis de nombreuses années « des traitements non conformes à la réglementation, notamment en raison de contaminations sporadiques d’origine bactérienne ou chimique ».

Selon les informations des deux médias à l’origine de l’enquête, au moins « un tiers des marques françaises d’eau de source et d’eau minérale auraient été, ou seraient encore, en délicatesse avec la réglementation ». Sont ainsi concernées les marques de Nestlé Waters (Vittel, Hépar, Perrier, etc.), filiale du groupe suisse Nestlé, et Source Alma (St-Yorre, Cristalline, etc.).

LIRE AUSSI : Comment l’eau est devenue le cœur du combat des écologistes radicaux

D’après l’enquête du Monde et de Radio France, le ministère de l’Industrie, alerté par la répression des fraudes, a reçu dès 2021 les représentants de Nestlé Waters, qui ont reconnu leur recours à des traitements d’ultraviolets et de filtres au charbon actif sur certaines eaux minérales afin de maintenir « leur sécurité alimentaire ». Le gouvernement, qui aurait alors dû informer la Commission européenne, « a tenté de gérer la crise avec la plus grande discrétion », révèle Le Monde.

Un rapport de l’Inspection générale des affaires sociales, que les deux médias ont pu consulter, a par ailleurs été « soumis à un secret quasi-absolu » par l’exécutif. Pour cause, ce rapport estime que 30 % des marques françaises ont recours à des traitements non conformes. « La mission n’a pas de doute sur le fait que la proportion de 30 % [des dénominations commerciales concernées] sous-estime le phénomène et que l’ensemble des minéraliers soient concernés », rapporte le quotidien.

Des normes distinctes de celles qui concernent l’eau du robinet

Les traitements ultraviolets et les filtres au charbon actif sont formellement interdits par la réglementation de l’UE. Selon la directive européenne « relative à l’exploitation et à la mise dans le commerce des eaux minérales naturelles », les eaux minérales doivent être naturellement de haute qualité microbiologique – sous entendu, sans aucun traitement supplémentaire pour atteindre cet objectif.

À l’origine, les eaux minérales étaient des eaux médicales, vendues exclusivement pour des pathologies précises. Provenant d’une source souterraine, elles se caractérisent par une stabilité dans leur composition en minéraux (fluor, sodium, magnésium) – différente selon les marques.

LIRE AUSSI : Volvic, Evian, San Pellegrino… Les géants de l’eau minérale boivent la tasse

Ainsi, tout traitement de ces eaux commercialisées en bouteille est interdit car elles sont soumises à des normes spécifiques. Ces dernières sont distinctes de celles qui régissent l’eau du robinet. Certaines eaux pourraient même être refusées en réseau public de distribution tant elles atteignent des teneurs en minéraux qui ne seraient pas tolérées pour une eau dite potable.

Au micro de France Info en 2022, la journaliste du magazine Que choisir Elisabeth Chesnais notait par exemple la forte présence de sodium dans certaines eaux minérales. Actuellement, pour l’eau du robinet, la limite autorisée du sodium est de 200 milligrammes par litre, alors que certaines eaux en bouteille peuvent en contenir plus de 1 000 milligrammes par litre.

63 critères de potabilité

Afin qu’une eau puisse être qualifiée de « potable », elle doit pouvoir être bue ou utilisée « à des fins domestiques et industrielles sans risque pour la santé », est-il précisé sur le site du Centre de l’information sur l’eau.

L’eau du robinet est prélevée par captage dans les nappes superficielles, les rivières ou les lacs, est décontaminée dans une usine de traitement jusqu’à ce qu’elle respecte les quelque 63 critères de potabilité dictés par le ministère de la Santé et le Conseil supérieur du secteur d’hygiène publique, une instance consultative.

LIRE AUSSI : Accélérer sur la réutilisation des eaux usées traitées : « On a une marge de progression énorme »

Parmi ces critères, on retrouve notamment des paramètres physico-chimiques, correspondant à la température ou à la dureté de l’eau, mais également organoleptiques, liés à la couleur, au goût et à l’odeur de l’eau. Bien qu’elle suscite parfois la méfiance, l’eau du robinet est très contrôlée au niveau local par les Agences régionales de santé et par les usines de traitement.

Alzheimer : les chercheurs ont trouvé un lien avec les aliments transformés !

Les aliments transformés sont suspectés d'augmenter le risque d'Alzheimer d'après une étude australienne. © Andrey Popov, Adobe Stock

 

Pour la première fois, une étude établit un lien entre les aliments transformés, en particulier la charcuterie et les aliments à base de viande, et la maladie d’Alzheimer. Publiée dans le Journal of Alzheimer’s Disease, la recherche australienne a utilisé les données de l’Australian Imaging Biomarker and Lifestyle Study of Aging, qui suit depuis près de 20 ans un groupe de personnes et observe le développement ou non de la maladie d’Alzheimer. Les chercheurs ont examiné le régime alimentaire de 438 Australiens (dont 108 atteints par la maladie) pour trouver cette association.

PAS LE TEMPS DE LIRE ? ON VOUS PARLE DE CETTE ACTU AU FORMAT AUDIO DANS LA SANTÉ SUR ÉCOUTE. APPUYEZ SUR LE BOUTON PLAY ET LAISSEZ-VOUS PORTER ! © FUTURA

Résultat : les patients souffrant de la maladie d’Alzheimer avaient tendance à manger régulièrement des aliments tels que des tourtes à la viande, des saucisses, du jambon, des pizzas et des hamburgers. De plus, ils consommaient également moins de fruits et légumes comme les oranges, les fraises, les avocats, les poivrons, les concombres, les carottes, les choux et les épinards, c’est-à-dire des aliments bruts non transformés.

Agir sur les facteurs de risque modifiables dès le plus jeune âge

L’auteure principale de l’étude Tahera Ahmed a déclaré dans un communiqué qu’elle espérait que ces résultats encourageraient les jeunes à adopter un régime alimentaire plus sain afin de protéger leur cerveau pour plus tard. « Le développement de la maladie d’Alzheimer dans le cerveau commence à l’âge moyen et ses effets peuvent être attribués à un mode de vie incontrôlé dès le plus jeune âge », a-t-elle ajouté. L’étude vient appuyer l’intérêt d’agir sur les facteurs de risque modifiables de la maladie d’Alzheimer, comme l’alimentation et le sommeil. Il a déjà été montré par le passé que les régimes sains comme le régime méditerranéen et le régime cétogène pourraient protéger de la démence.

 

 

Source : Alzheimer : les chercheurs ont trouvé un lien avec les aliments transformés !

 

Pour la première fois, une étude établit un lien entre les aliments transformés, en particulier la charcuterie et les aliments à base de viande, et la maladie d’Alzheimer. Publiée dans le Journal of Alzheimer’s Disease, la recherche australienne a utilisé les données de l’Australian Imaging Biomarker and Lifestyle Study of Aging, qui suit depuis près de 20 ans un groupe de personnes et observe le développement ou non de la maladie d’Alzheimer. Les chercheurs ont examiné le régime alimentaire de 438 Australiens (dont 108 atteints par la maladie) pour trouver cette association.

PAS LE TEMPS DE LIRE ? ON VOUS PARLE DE CETTE ACTU AU FORMAT AUDIO DANS LA SANTÉ SUR ÉCOUTE. APPUYEZ SUR LE BOUTON PLAY ET LAISSEZ-VOUS PORTER ! © FUTURA

Résultat : les patients souffrant de la maladie d’Alzheimer avaient tendance à manger régulièrement des aliments tels que des tourtes à la viande, des saucisses, du jambon, des pizzas et des hamburgers. De plus, ils consommaient également moins de fruits et légumes comme les oranges, les fraises, les avocats, les poivrons, les concombres, les carottes, les choux et les épinards, c’est-à-dire des aliments bruts non transformés.

Agir sur les facteurs de risque modifiables dès le plus jeune âge

L’auteure principale de l’étude Tahera Ahmed a déclaré dans un communiqué qu’elle espérait que ces résultats encourageraient les jeunes à adopter un régime alimentaire plus sain afin de protéger leur cerveau pour plus tard. « Le développement de la maladie d’Alzheimer dans le cerveau commence à l’âge moyen et ses effets peuvent être attribués à un mode de vie incontrôlé dès le plus jeune âge », a-t-elle ajouté. L’étude vient appuyer l’intérêt d’agir sur les facteurs de risque modifiables de la maladie d’Alzheimer, comme l’alimentation et le sommeil. Il a déjà été montré par le passé que les régimes sains comme le régime méditerranéen et le régime cétogène pourraient protéger de la démence.

 

 

Suppression de l’ASS : « Des foyers modestes risquent de s’enfoncer dans le surendettement », alerte Denis Gravouil (CGT) – L’Humanité

 

François Hommeril, président de la CFE-CGC, le syndicat des cadres, a également fustigé une mesure « gravissime »« Considérer que quand les personnes ne retrouvent pas d’emploi, c’est de leur faute » est un « mensonge insupportable » qui nie « toutes les études en la matière », estime-t-il. L’économiste Michaël Zemmour partage ces analyses. « Cohérente avec la politique du gouvernement depuis plusieurs années, cette mesure consiste à accroître le dénuement des personnes hors de l’emploi, afin de « creuser l’écart » avec les personnes en emploi, sans toutefois que les salaires n’augmentent », poursuit-il.

 

 

 

Source : Suppression de l’ASS : « Des foyers modestes risquent de s’enfoncer dans le surendettement », alerte Denis Gravouil (CGT) – L’Humanité

 

Suppression de l’ASS : « Des foyers modestes risquent de s’enfoncer dans le surendettement », alerte Denis Gravouil (CGT)

Durant une bonne partie de sa déclaration de politique générale à l’Assemblée nationale mardi 30 janvier, le premier ministre Gabriel Attal a vanté la politique d’Emmanuel Macron, en particulier sur le travail. Il a surtout annoncé vouloir supprimer l’allocation de solidarité spécifique (ASS), provoquant la colère des syndicalistes et des politiques de gauche.

Gabriel Attal a réitéré, mardi 30 janvier, l’« objectif de plein-emploi » du gouvernement avec la même recette : s’attaquer aux droits des chômeurs. ©AFP

Lors de sa déclaration de politique générale à l’Assemblée nationale, mardi 30 janvier, Gabriel Attal a annoncé vouloir supprimer l’allocation de solidarité spécifique (ASS) qui prolonge l’indemnisation du chômage tout en cotisant jusqu’à la retraite pour les privés d’emploi les plus âgés, dans le but de « réinterroger notre modèle » du travail. Après avoir loué la politique de son président, pointant un taux de chômage qui serait le plus bas « depuis vingt-cinq ans » tout en omettant de souligner que le chiffre est le fruit des réformes de l’allocation-chômage retirant leurs droits à plusieurs milliers de sans-emploi, le premier ministre a persisté en annonçant cette terrible mesure anti-sociale qui faisait débat au sein même de la majorité.

Une suppression de l’ASS « gravissime »

Denis Gravouil, membre du bureau confédéral de la CGT, estime que cette mesure est « gravissime »« Ce sont environ 300 000 personnes par an, à qui on va retirer le dernier revenu d’existence », explique le militant CGT, rappelant que, si ces personnes basculeront au RSA (Revenu de solidarité active), il existe une différence essentielle entre ASS et RSA, passée sous silence par le gouvernement. L’ASS n’est pas rattachée au foyer, « autrement dit, vous en bénéficiez quel que soit le revenu de votre conjoint ou conjointe, contrairement au RSA, qui dépend des revenus du ménage », explique Denis Gravouil. « Cela signifie que des gens en couple qui touchaient l’ASS pourront se retrouver sans rien, en fonction des revenus de leur conjoint. Des foyers modestes risquent de s’enfoncer dans le surendettement. » Sans compter que le premier ministre a également annoncé la généralisation du conditionnement du RSA à 15 heures d’activité.

Sur le même thème

Logement, santé, climat : ce qu’il faut retenir de la déclaration de politique générale très à droite de Gabriel Attal

Interrogé au micro de franceinfo quelques heures après la longue déclaration de Gabriel Attal, François Hommeril, président de la CFE-CGC, le syndicat des cadres, a également fustigé une mesure « gravissime »« Considérer que quand les personnes ne retrouvent pas d’emploi, c’est de leur faute » est un « mensonge insupportable » qui nie « toutes les études en la matière », estime-t-il. L’économiste Michaël Zemmour partage ces analyses. « Cohérente avec la politique du gouvernement depuis plusieurs années, cette mesure consiste à accroître le dénuement des personnes hors de l’emploi, afin de « creuser l’écart » avec les personnes en emploi, sans toutefois que les salaires n’augmentent », poursuit-il.

« Un objectif de punition sociale »

Selon le spécialiste du financement de l’État social, cette politique s’inscrit dans la droite ligne des précédentes réformes engagées par le gouvernement dans ce domaine. Elle poursuit « un objectif de punition sociale des personnes hors de l’emploi pour récompenser implicitement celles qui en ont un »« En dégradant les conditions de vie hors de l’emploi on pousse les personnes à accepter tout type d’activité, même dans des conditions de travail et de rémunération très dégradées », ajoute-t-il.

Sur le même thème

France Travail, un projet « purement coercitif »

Par ailleurs, le premier ministre fait peser une nouvelle épée de Damoclès sur l’assurance-chômage, indiquant qu’en cas de trajectoire financière négative, il adresserait « une lettre de cadrage » aux partenaires sociaux. Une façon de tordre le bras à ces derniers pour réduire les droits des chômeurs. Enfin, le Code du travail pourrait encore perdre en épaisseur, Gabriel Attal promettant une « nouvelle étape » aux ordonnances de 2017, dont les effets sur la protection des salariés ont été destructeurs. Dans un contexte où le gouvernement multiplie les ballons d’essais pour attaquer le droit des chômeurs, et en particulier des seniors, les macronistes peinent à justifier une mesure qui n’arrangera en rien le chômage et la précarité des Français.

Les mots-clés associés à cet article

 

 

 

Sans Charles de Gaulle, les relations France-Chine auraient été bien différentes | Slate.fr

<p>Le général Charles de Gaulle, le 16 mars 1963.|&nbsp;Eric Koch for Anefo <a href="https://commons.wikimedia.org/wiki/File:Bezoek_President_De_Gaulle_aan_Nederland._Nr._4,_5,_6,_7_De_Gaulle,_Bestanddeelnr_914-9330.jpg">via Wikimedia Commons</a><br></p>

Le général Charles de Gaulle, le 16 mars 1963.| Eric Koch for Anefo via Wikimedia Commons

 

De son côté, Charles de Gaulle commente cette reconnaissance diplomatique quatre jours plus tard, le 31 janvier, au cours d’une des deux conférences de presse qu’il organise chaque année. Il passe vingt minutes à expliquer que «le poids de l’évidence et de la raison pesant chaque jour d’avantage, la République française a décidé de placer ses rapports avec la République populaire de Chine sur un plan normal, autrement dit diplomatique». Il présente «cet État plus ancien que l’histoire, […] constamment résolu à l’indépendance, s’efforçant sans relâche à la centralisation, replié d’instinct sur lui-même et dédaigneux des étrangers, mais conscient et orgueilleux d’une immuable pérennité, telle est la Chine de toujours!».De Gaulle parle aussi de la place stratégique de la Chine et des espoirs que la France place dans une coopération technique et culturelle avec ce pays. À l’attention de tous ceux, notamment aux États-Unis, qui désapprouvent avec virulence cette initiative française, il précise: «Il n’y a évidemment là rien qui implique aucune sorte d’approbation à l’égard du régime qui domine actuellement la Chine.»«Il n’y a pas de pays qui n’a pas de tache dans son histoire»Très vite, un petit groupe de diplomates français part pour Pékin afin de préparer l’installation d’une ambassade de France. Claude Chayet mène cette délégation. Il a vécu enfant en Chine où, autour de 1930, son père était diplomate. Avant de quitter Paris, il est reçu à l’Élysée par le général de Gaulle et racontera plus tard lui avoir «demandé s'[il] devai[t] exiger de récupérer l’ambassade d’avant l’arrivée des communistes en 1949». Celle-ci se situait dans l’ancien quartier des concessions et, précisait Claude Chayet, «pour les Chinois, les concessions sont une tache dans l’histoire». «Il n’y a pas de pays qui n’a pas de tache dans son histoire, répond le général. Vous réclamerez une ambassade.»

Source : Sans Charles de Gaulle, les relations France-Chine auraient été bien différentes | Slate.fr

 

Sans Charles de Gaulle, les relations France-Chine auraient été bien différentes

Le 27 janvier 1964, le général liait officiellement la France à «cet État plus ancien que l’histoire», alors ignoré par l’Occident et brouillé avec l’Union soviétique. Une décision qui a notamment préparé le terrain au président américain Richard Nixon.

<p>Le général Charles de Gaulle, le 16 mars 1963.|&nbsp;Eric Koch for Anefo <a href="https://commons.wikimedia.org/wiki/File:Bezoek_President_De_Gaulle_aan_Nederland._Nr._4,_5,_6,_7_De_Gaulle,_Bestanddeelnr_914-9330.jpg">via Wikimedia Commons</a><br></p>
Le général Charles de Gaulle, le 16 mars 1963.| Eric Koch for Anefo via Wikimedia Commons

Temps de lecture: 8 minutes

En 1964, il y a soixante ans, la guerre d’Algérie avait pris fin depuis deux ans et le général de Gaulle estimait que le temps était venu d’affirmer «la volonté de la France de disposer d’elle-même». Il s’agissait donc de mettre en avant des positions véritablement françaises sur quelques dossiers internationaux. Dès lors, l’Hexagone prenait ses distances avec l’OTAN et, en 1966, elle allait quitter sa participation au commandement de cette organisation de défense dominée par les États-Unis.

Dans une même logique d’indépendance, Charles de Gaulle s’éloignait de la politique indochinoise américaine et refusait d’envoyer des troupes au Vietnam comme le suggérait le pacte de Manille. Mais le plus spectaculaire a été, en janvier 1964, l’établissement de relations diplomatiques franco-chinoises.

La Chine était alors ignorée par l’ensemble du monde occidental et, depuis 1960, elle était également brouillée avec l’Union soviétique. En octobre 1963, Edgar Faure, qui a été président du Conseil sous la IVe République, est envoyé secrètement par de Gaulle en mission à Pékin. Il constate que les principaux dirigeants chinois, dont Mao Zedong et Zhou Enlai, sont d’accord pour établir des relations avec la France.

Plus tard, c’est André Bettencourt qui se rend en Chine pour établir les détails de ce rapprochement diplomatique avec la France. Cet homme politique, qui est aussi l’un des dirigeants de L’Oréal, a été ministre dans les années 1950 et le sera à nouveau en 1966. Avec ces deux émissaires français, les dirigeants chinois insistent sur un point: la France doit rompre ses relations avec le régime nationaliste de Taïwan.

Le «geste très important» de la France

Le 27 janvier 1964, la reconnaissance diplomatique entre Paris et Pékin est établie. Le ministère chinois des Affaires étrangères en informe aussitôt Mao Zedong. À cette époque, celui-ci est quelque peu tenu à l’écart du pouvoir pour avoir, en 1959 et 1960, mené la politique du «Grand Bond en avant», qui a entraîné un véritable désastre économique. Mao Zedong a donc du temps pour étudier l’anglais avec une diplomate anglophone, Zhang Hanzi. Celle-ci racontera bien plus tard que «Mao s’ennuyait, c’est pour ça qu’il [lui] avait demandé de lui donner des cours d’anglais. [Ils] travaillai[en]t sur la version anglaise de ses écrits.» Ce 27 janvier 1964, Mao Zedong déclare à Zhang Hanzi que la France a fait «un geste très important».

De son côté, Charles de Gaulle commente cette reconnaissance diplomatique quatre jours plus tard, le 31 janvier, au cours d’une des deux conférences de presse qu’il organise chaque année. Il passe vingt minutes à expliquer que «le poids de l’évidence et de la raison pesant chaque jour d’avantage, la République française a décidé de placer ses rapports avec la République populaire de Chine sur un plan normal, autrement dit diplomatique». Il présente «cet État plus ancien que l’histoire, […] constamment résolu à l’indépendance, s’efforçant sans relâche à la centralisation, replié d’instinct sur lui-même et dédaigneux des étrangers, mais conscient et orgueilleux d’une immuable pérennité, telle est la Chine de toujours!».

De Gaulle parle aussi de la place stratégique de la Chine et des espoirs que la France place dans une coopération technique et culturelle avec ce pays. À l’attention de tous ceux, notamment aux États-Unis, qui désapprouvent avec virulence cette initiative française, il précise: «Il n’y a évidemment là rien qui implique aucune sorte d’approbation à l’égard du régime qui domine actuellement la Chine.»

«Il n’y a pas de pays qui n’a pas de tache dans son histoire»

Très vite, un petit groupe de diplomates français part pour Pékin afin de préparer l’installation d’une ambassade de France. Claude Chayet mène cette délégation. Il a vécu enfant en Chine où, autour de 1930, son père était diplomate. Avant de quitter Paris, il est reçu à l’Élysée par le général de Gaulle et racontera plus tard lui avoir «demandé s'[il] devai[t] exiger de récupérer l’ambassade d’avant l’arrivée des communistes en 1949». Celle-ci se situait dans l’ancien quartier des concessions et, précisait Claude Chayet, «pour les Chinois, les concessions sont une tache dans l’histoire»«Il n’y a pas de pays qui n’a pas de tache dans son histoire, répond le général. Vous réclamerez une ambassade.»

Mais une fois à Pékin, les autorités chinoises font savoir à Claude Chayet qu’il sera très difficile de rendre à Paris son ancienne ambassade. Ce qui signifie que c’est un non définitif. Il est proposé à la France de choisir entre deux bâtiments à peu près semblables dans le quartier de Sanlitun, dans l’est de la capitale. «J’ai choisi celui où le salon était au rez-de-chaussée, en me disant qu’il n’y aurait pas de jambes cassées dans l’escalier lors des réceptions du 14-Juillet», explique Claude Chayet, qui occupera les fonctions de premier conseiller jusqu’en 1966. Quant à l’ambassade de France, elle restera au même endroit jusqu’en 2011, année durant laquelle un autre bâtiment sort de terre pour l’accueillir.

En mai 1964, le premier ambassadeur de France dans la Chine communiste prend ses fonctions à Pékin. Il s’agit de Lucien Paye, un diplomate gaulliste qui a notamment été ministre de l’Éducation nationale en 1961. Il est très favorablement accueilli par les autorités chinoises. La France est alors bien vue à Pékin pour avoir condamné l’intervention américaine au Vietnam et refusé de signer, en 1963, un accord proposé par Moscou en vue de limiter l’expérimentation des bombes nucléaires. Dans ce domaine, la France est prévenue avant tout autre pays lorsque la Chine, en octobre 1964, devient la cinquième puissance nucléaire au monde en faisant exploser sa première bombe atomique sur le site du Lob Nor, dans la région du Xinjiang.

Le dîner d’André Malraux au Palais du peuple

L’ambassadeur a de bons contacts avec Chen Yi, le ministre chinois des Affaires étrangères. Il est l’un des très rares diplomates autorisés à voyager dans de lointaines provinces, comme le Sichuan ou le Yunnan. Et Lucien Paye est aussi aux côtés d’André Malraux –alors ministre de la Culture– lorsque celui-ci rencontre Mao Zedong au cours d’un dîner au Palais du peuple en 1965.

Curieusement, dans ses Antimémoires, publiées en 1967, André Malraux ne relate pas que le dirigeant chinois lui a fait part de son désir de bousculer le mode de direction de la Chine. Cette annonce de la Révolution culturelle est en revanche remarquée par les quelques autres Français qui accompagnent le ministre. Parmi eux, se trouvent André Bettencourt qui, de retour à Paris raconte ses impressions sur Mao Zedong en disant: «C’est à la fois un grand homme d’État, c’est incontestable, c’est aussi un philosophe, on pourrait même dire que c’est un sage.»

Sur le plan commercial, les retombées de la reconnaissance diplomatique sont limitées même si, en 1965, une exposition de produits industriels français est organisée à Pékin. En matière aéronautique, la Chine semble avoir été intéressée par l’achat de Caravelle. Mais la présence, dans les moteurs de cet avion, de plusieurs éléments américains empêchera toute vente par la France. En revanche, Berliet parviendra à fournir à la Chine des exemplaires de son camion «100 tonnes» en les exportant à partir d’une usine située en Algérie. Quant au procédé de télévision Sécam, il ne sera pas acheté mais copié par des techniciens chinois. Ce seront finalement le blé et les céréales qui seront les principales exportations françaises vers la Chine.

Bisbilles autour du bâtiment de l’avenue George-V

Parallèlement, Huang Zhen, ancien compagnon de Mao Zedong lors de la Longue Marche, a été nommé ambassadeur à Paris, où il arrive en juin 1964. En février, un chargé d’affaires, Song Zhiguang, l’a précédé en compagnie de cinq diplomates parmi lesquels Wang Hua, 26 ans, parfait francophone. Venus de Genève, ils sont attendus gare de Lyon par une centaine de journalistes.

Logiquement, ils auraient dû s’installer dans l’ambassade de Chine, avenue George-V, dans le VIIIe arrondissement de Paris, mais les Taïwanais ont fait de ce lieu leur ambassade auprès de l’Unesco. Les six diplomates venus de Pékin logent donc à l’hôtel Intercontinental. «Ce qu’on mangeait au restaurant était détaillé dans les journaux du lendemain. Mais quand on sortait en veste grise à col Mao, les gens nous faisaient des signes d’amitié»se souviendra Wang Hua.

Au bout de deux mois, les diplomates chinois louent un immeuble à Neuilly. Wang Hua repère une villa en vente qui convient comme résidence pour l’ambassadeur. La propriétaire est américaine; l’ambassade des États-Unis à Paris lui déconseille de conclure. Les Chinois la persuadent que, dans une économie de marché, chacun est libre de vendre à qui il veut.

En janvier 1965, lors des vœux au corps diplomatique à l’Élysée, Charles de Gaulle demande à Huang Zhen si son installation à Paris se passe bien. L’ambassadeur s’enhardit à répondre que ce serait sans doute mieux si la Chine populaire pouvait s’installer dans le bâtiment de l’avenue George-V. Dans les jours qui suivent, les diplomates taïwanais sont vivement invités à laisser la place aux Chinois de Pékin. L’ordre est venu du cabinet du général.

«Être traité de chiens par des Pékinois, voilà qui est cocasse»

Mais à partir du printemps 1966, le déclenchement de la Révolution culturelle change totalement l’atmosphère politique à Pékin. Les contacts avec l’ambassade de France s’arrêtent. Dans le but de reprendre totalement le pouvoir, Mao Zedong commence par provoquer un climat de désordre maximum en appelant à la révolte des masses contre les dirigeants et les élites. Tout est bon pour critiquer l’ordre établi, y compris dans le domaine international. En 1967, des Gardes rouges manifestent devant l’ambassade de France pour protester contre des incidents survenus à Paris lorsque la police a empêché des étudiants chinois de s’attaquer à l’ambassade soviétique.

Puis, en soutien à des manifestations survenues à Djibouti –qui était alors, sous le nom de Côte française des Somalis, un territoire d’outre-mer français–, il est écrit en idéogrammes sur un mur de l’ambassade de France à Pékin: «À bas les têtes de chiens français! Sortez de Djibouti!»

La municipalité de Pékin ne parviendra jamais à effacer ces phrases qui, au fil des années, réapparaîtront régulièrement les jours de pluies. Mais sur le moment, en août 1967, alors qu’il reçoit le général Jacques Guillermaz, brillant sinologue qui vient de quitter son poste d’attaché militaire à Pékin, Charles de Gaulle ironise en disant: «Être traité de chiens par des Pékinois, voilà qui est cocasse.» Avant d’estimer, devant son hôte, que «les avantages immédiats de la reconnaissance de la Chine ne sont pas apparents». L’année suivante, Pékin approuve solennellement les révoltes de Mai 68 à Paris, au cours desquelles s’illustrent quelques groupes maoïstes.

Tout au long de cette période durant laquelle la Révolution culturelle bat son plein en Chine, l’ambassade à Paris se montre particulièrement discrète. Un groupe de diplomates qui se sont décrétés Gardes rouges veille à établir une parfaite égalité. Il est ainsi très probable que l’ambassadeur ait été obligé, certains jours, de se tenir au standard téléphonique.

Ce que Richard Nixon doit à Charles de Gaulle

Un voyage de Charles de Gaulle en Chine était en préparation pour le printemps 1971. Il n’aura pas lieu, le général étant mort en novembre 1970. C’est Maurice Couve de Murville, qui avait été ministre des Affaires étrangères puis Premier ministre du général, qui effectue une visite à Pékin et dans quelques autres villes chinoise en 1970. À son retour, comme des journalistes lui demandent ses impressions de voyage, il répond par cette phrase d’une parfaite banalité diplomatique: «La Chine est un grand pays plein de contrastes.»

Mais en ces débuts des années 1970, la Chine va décider de sortir de son isolement. Craignant une attaque soviétique, Mao Zedong et Zhou Enlai reçoivent secrètement le conseiller à la sécurité nationale des États-Unis Henry Kissinger, ce qui prépare la visite en Chine du président américain Richard Nixon de février 1972. L’année suivante, Georges Pompidou effectue le premier voyage d’un président de la République française en Chine.

Après la mort de Mao en 1976 puis, deux ans plus tard, l’arrivée au pouvoir de Deng Xiaoping, la Chine entame des réformes qui vont l’amener à s’ouvrir économiquement au reste du monde. Dès lors, Paris est en concurrence avec les autres puissances occidentales, qui, les unes après les autres, ont reconnu Pékin. Tout au plus, Henry Kissinger et Richard Nixon diront-ils que le général de Gaulle leur a préparé le terrain. Et en Chine, citer Charles de Gaulle est resté une obligation dans tout discours officiel où il est question de la France.

En savoir plus

 

 

 

L’exercice physique augmente la taille du cerveauPratiquer une activité physique modérée de façon régulière suffirait à préserver sa santé cérébrale. Les chercheurs montrent que des volumes cérébraux plus importants sont associés à l’exercice physique, ce qui pourrait aider à retarder le déclin cognitif lié à l’âge.

 Le sport, un partenaire pour vieillir en bonne santé ? © Malchevska Studio, Adobe Stock

Pratiquer une activité physique modérée de façon régulière suffirait à préserver sa santé cérébrale. Les chercheurs montrent que des volumes cérébraux plus importants sont associés à l’exercice physique, ce qui pourrait aider à retarder le déclin cognitif lié à l’âge.

L’étude publiée dans le Journal of Alzheimer’s Disease a inclus 10 125 participants en bonne santé (53 ans en moyenne, une moitié de femmes).

Les trois quarts d’entre eux ont déclaré pratiquer une activité physique modérée ou vigoureuse environ quatre jours par semaine, définie par des activités augmentant la respiration et le pouls pendant au moins 10 minutes continues comme la marche et la course à pied.

La recherche a examiné leurs scanners cérébraux (par IRM) et a mis en évidence que les personnes sportives avaient des volumes cérébraux plus importants que les autres.

Si les « 10 000 pas par jour » sont populaires, 4 000 pas au quotidien seraient suffisants pour présenter un effet positif sur la santé du cerveau d’après les chercheurs.

Source : L’exercice physique augmente la taille du cerveau

 Le sport, un partenaire pour vieillir en bonne santé ? © Malchevska Studio, Adobe Stock

L’exercice physique augmente la taille du cerveau

Selon une nouvelle étude américaine, une activité physique même modérée est associée à une augmentation des volumes cérébraux, ce qui indique de potentiels effets neuroprotecteurs. Les régions du cerveau concernées – la matière grise, la matière blanche, l’hippocampe, et les lobe frontal, pariétal et occipital – sont responsables de la mémoire, de l’apprentissage ou encore des capacités de décision. Même si un « gros » cerveau ne garantit pas forcément une fonctionnalité cognitive accrue, il est souvent considéré comme un bon indicateur de l’évolution des capacités cognitives.

L’étude publiée dans le Journal of Alzheimer’s Disease a inclus 10 125 participants en bonne santé (53 ans en moyenne, une moitié de femmes). Les trois quarts d’entre eux ont déclaré pratiquer une activité physique modérée ou vigoureuse environ quatre jours par semaine, définie par des activités augmentant la respiration et le pouls pendant au moins 10 minutes continues comme la marche et la course à pied. La recherche a examiné leurs scanners cérébraux (par IRM) et a mis en évidence que les personnes sportives avaient des volumes cérébraux plus importants que les autres. Si les « 10 000 pas par jour » sont populaires, 4 000 pas au quotidien seraient suffisants pour présenter un effet positif sur la santé du cerveau d’après les chercheurs.

Le sport, un partenaire pour vieillir en bonne santé ?

Avec l’âge, cet effet bénéfique est de plus en plus important car la possibilité de développer une maladie neurodégénérative (comme la maladie d’Alzheimer) s’accroît. Les chercheurs estiment que des volumes cérébraux plus importants peuvent aider à retarder le déclin cognitif qui accompagne ces maladies. « Non seulement l’exercice physique réduit le risque de démence, mais il contribue également à maintenir la taille du cerveau, ce qui est crucial à mesure que nous vieillissons », conclut le radiologue Cyrus Raji, de l’université Washington à Saint-Louis.

 

 

 

 

 

 

L’arrêt du support de Windows 10 va-t-il vraiment transformer 240 millions de PC en déchets électroniques ?

250 millions de PC pourraient finir dans les décharges. © Sylvain Biget, généré avec Bing Image Creator

 

Microsoft a programmé la fin du support de Windows 10 pour 2025. Or, de nombreux ordinateurs ne sont pas compatibles avec Windows 11 et, d’ici deux ans, cela fera des centaines de millions de PC qui ne pourront pas bénéficier de mises à jour de sécurité et deviendront au mieux vulnérables, au pire dangereux ou inutilisables.

 

Source : L’arrêt du support de Windows 10 va-t-il vraiment transformer 240 millions de PC en déchets électroniques ?

 

 

pour rappel en 2015  :

 

Windows 10 sera la dernière révision majeure du système d’exploitation.

Jerry Nixon, un responsable du développement de Microsoft, a déclaré dans un discours de conférence cette semaine que Windows 10 serait la « dernière version » du logiciel de bureau dominant.

Ses commentaires ont été repris par Microsoft qui a déclaré qu’il mettrait à jour Windows à l’avenir d’une « façon continue ».

Au lieu de nouvelles versions autonomes, Windows 10 serait amélioré par tranches régulières, a déclaré la société.

M. Nixon a fait ses commentaires lors de la conférence Ignite de Microsoft tenue à Chicago cette semaine.

Dans un communiqué, Microsoft a déclaré que les commentaires de M. Nixon reflétaient un changement dans la façon dont il fabriquait son logiciel.

« Windows sera livré en tant que service apportant de nouvelles innovations et mises à jour de manière continue », a-t-il déclaré, ajoutant qu’il s’attendait à un « long avenir » pour Windows.

‘Pas de Windows 11’

 

Microsoft arrête de produire des versions Windows

  • Publié
Lancement de windows 98SOURCE D’IMAGE,AP
Légende d’image,

Le lancement d’une nouvelle version de Windows était un événement majeur

Windows 10 sera la dernière révision majeure du système d’exploitation.

Jerry Nixon, un responsable du développement de Microsoft, a déclaré dans un discours de conférence cette semaine que Windows 10 serait la « dernière version » du logiciel de bureau dominant.

Ses commentaires ont été repris par Microsoft qui a déclaré qu’il mettrait à jour Windows à l’avenir d’une « façon continue ».

Au lieu de nouvelles versions autonomes, Windows 10 serait amélioré par tranches régulières, a déclaré la société.

M. Nixon a fait ses commentaires lors de la conférence Ignite de Microsoft tenue à Chicago cette semaine.

Dans un communiqué, Microsoft a déclaré que les commentaires de M. Nixon reflétaient un changement dans la façon dont il fabriquait son logiciel.

« Windows sera livré en tant que service apportant de nouvelles innovations et mises à jour de manière continue », a-t-il déclaré, ajoutant qu’il s’attendait à un « long avenir » pour Windows.

‘Pas de Windows 11’

La société a déclaré qu’elle n’avait pas encore décidé comment appeler le système d’exploitation au-delà de Windows 10.

« Il n’y aura pas de Windows 11 », a averti Steve Kleynhans, vice-président de la recherche chez Gartner, qui surveille Microsoft.

Il a déclaré que Microsoft avait par le passé délibérément évité d’utiliser le nom « Windows 9 » et a plutôt choisi Windows 10 comme un moyen de signifier une rupture avec un passé qui impliquait des versions autonomes successives du système d’exploitation.

Cependant, a-t-il déclaré, travailler de cette manière avait créé de nombreux problèmes pour Microsoft et ses clients.

« Tous les trois ans environ, Microsoft s’asseyait et créait ‘le prochain grand OS' », a-t-il déclaré.

Minecraft démoSOURCE D’IMAGE,MICROSOFT
Légende d’image,

Microsoft a développé le système de réalité augmentée HoloLens pour Windows 10

« Les développeurs seraient enfermés et sortiraient un produit basé sur ce que le monde voulait il y a trois ans. »

Microsoft a également dû dépenser une énorme somme d’argent et de marketing pour convaincre les gens qu’ils avaient besoin de cette nouvelle version, et que c’était mieux que tout ce qui était venu auparavant, il a expliqué.

Le passage à une situation dans laquelle Windows est un service constamment mis à jour sortira de ce cycle, et laissez Microsoft bricoler davantage avec le logiciel pour tester de nouvelles fonctionnalités et voir comment les clients les aiment.

‘Étape positive’

La plupart des revenus générés par Windows pour Microsoft provenaient des ventes de nouveaux PC et il était peu probable que cela soit affecté par le changement, a souligné M. Kleynhans.

« Dans l’ensemble, c’est une étape positive, mais elle comporte certains risques », a-t-il déclaré.

« Microsoft devra travailler dur pour continuer à générer des mises à jour et de nouvelles fonctionnalités, a-t-il déclaré, ajoutant que des questions restaient encore sur la façon dont les entreprises s’adapteraient au changement et comment Microsoft fournirait un support.

« Cela ne signifie pas que Windows est gelé et n’avancera plus jamais », a déclaré M. Kleynhans à la BBC.

« En effet, nous sommes sur le point de voir le contraire, avec la vitesse des mises à jour de Windows passant à la vitesse supérieure. »

 

https://www.bbc.com/news/technology-32658340

 

 

ou ceci :

Windows 10 sera le dernier Windows, enfin, plus ou moins

Windows 10 sera le dernier Windows. C’est Microsoft qui le dit. Dans les années à venir, Microsoft cessera de proposé des mises à jour majeures numérotée, préférant une constante évolution.

JEROME_DUREL

  • 1 min

Windows 10 sera le dernier Windows, enfin, plus ou moins

Windows 10 serait le dernier représentant du modèle économique de Microsoft pour Windows. À l’occasion de la conférence Ignite, Jerry Nixon, responsable du développement de Microsoft, a expliqué que « Windows 10 [serait] la dernière version de Windows« . Cela fait peur dit comme ça, mais rassurez-vous, cela ne veut pas dire qu’une fois sorti, Windows n’évoluera plus jamais.

En réalité, c’est surtout le mode d’intégration des mises à jour. Contrairement à ce qu’il se passe aujourd’hui où Microsoft, propose des mises à jour majeures (payantes) telles que Windows Vista, 7 ou 8, Windows sera mis à jour par petites touches, de manière transparente un peu comme Chrome. Les changements d’importance auront lieu, mais au fur et à mesure, afin de rester au goût du jour et non d’un coup, comme cela aurait pu l’être avec un Windows 11. C’est le principe « Windows as a Service ».

C’est à peu près tout ce que l’on sait pour le moment, Microsoft ne s’est en effet pas étendu sur le sujet. La bonne nouvelle pour Microsoft est que cette logique devrait à terme réduire l’effet de fragmentation entre les différentes versions de l’OS, l’adoption de Windows 10 grandira naturellement avec le temps, et cela devrait aller bien plus vite qu’à l’accoutumée puisqu’on rappelle que Windows 10 sera proposé gratuitement au grand public. La donne sera en revanche plus complexe pour les entreprises, dont le processus d’adoption d’une nouvelle version est nécessairement plus long, mais elles devraient au final elles aussi gagner en souplesse.

https://www.cnetfrance.fr/news/windows-10-sera-le-dernier-windows-enfin-plus-ou-moins-39819132.ht

ou

 

 

Windows 10 sera le “dernier Windows” pour Microsoft

N’angoissez pas trop vite, Windows ne va pas disparaître du jour au lendemain. Microsoft s’apprête simplement à revoir intégralement son cycle de mise à jour et ça commence avec Windows 10 qui va amorcer une mini révolution dans les habitudes de la firme de Redmond, et cette dernière aura des répercussions jusque dans les habitude des utilisateurs.

  • Pour aller plus loin : télécharger la dernière version test de Windows 10 !

Windows 10, dernier WIndows

L’exemple qu’il faut avoir en tête n’est autre que Apple. Pour son O.S. de bureau, la firme de Cupertino utilise le nom de OS X depuis plus de 15 ans sans que ses utilisateurs soient déboussolés. En pratique, seul change le nom des mise à jours majeures avec “Leopard”, “Lion”, “Yosemite”. Les responsables du développement envisagent-ils de s’inspirer de cette tendance.

Selon des propos rapportés par The Verge, pour la première fois de son existence, les développeurs ne travaillent pas sur un autre projet de Windows à l’heure actuelle. Par le passé, la firme a toujours eu un coup d’avance, en étant sur les travaux préparatoires du WIndows suivant. Il n’en est absolument rien cette année puisque Windows 10 occuperait encore toutes les équipes. C’est d’autant plus important que le passage à Windows 10 sera gratuit pour les utilisateurs d’un système précédent.

Lors de la conférence Ignite, Jerry Nixon, employé de Microsoft, expliquait que la société n’avait pas de mise à jour secrète dans ses cartons comme auparavant. A l’époque de Windows 8.1, Windows 10 était déjà en vue pour la firme de Redmond. Le scénario serait radicalement différent aujourd’hui. Et pour comprendre les raisons de ce revirement, référons-nous aux propos des géniteurs de Windows.

L’enjeu est ainsi d’envisager le système d’exploitation comme un “service”. L’idée serait ainsi de lisser les mises à jour et les versions majeures dans un cycle plus court. Peut-être à l’image de ce qu’il se pratique déjà avec les navigateurs web par exemple. Depuis l’arrivée de Chrome, le numéro de version n’a plus vraiment d’importance de par le nombre d’updates effectuées dans l’année.

Pour Windows, le message semble clair, le numéro de version est obsolète. Faut-il s’attendre à ce que Microsoft abandonne ce système au profit des noms de code ? L’avenir nous le dira.

Via

https://www.phonandroid.com/windows-10-sera-dernier-windows-pour-microsoft.html

 

 

 

 

 

 

 

Le plus ancien fort promontoire du monde: Amnya et l’accélération de la diversité des chasseurs-cueilleurs en Sibérie il y a 8000 ans | Antiquité | Cambridge Core

 

Les paysages boréaux subarctiques de la taïga sibérienne peuvent sembler lointains, mais c’est ici, il y a 8000 ans, que les chasseurs-cueilleurs ont construit des colonies fortifiées, plusieurs siècles avant l’apparition d’enceintes comparables en Europe (Figure 1′).

 

 

La construction de fortifications par des groupes de butineurs a été observée sporadiquement ailleurs dans le monde dans diverses régions de—principalement côtières— à partir de la préhistoire ultérieure, mais l’apparition très précoce de ce phénomène dans l’intérieur de la Sibérie occidentale est sans précédent.

 

Ce phénomène, largement inconnu des chercheurs internationaux, peut contribuer à la réévaluation critique des récits de voies linéaires vers le changement social de plus en plus explorés dans les débats scientifiques et populaires (ex. Dan-Cohen Référence Dan-Cohen2020; Graeber & Wengrow Référence Graeber et Wengrow2021′).

Source : Le plus ancien fort promontoire du monde: Amnya et l’accélération de la diversité des chasseurs-cueilleurs en Sibérie il y a 8000 ans | Antiquité | Cambridge Core

Résumé

Les récits archéologiques ont traditionnellement associé l’essor de la complexité sociale et politique ‘ ’ à l’émergence de sociétés agricoles. Cependant, ce cadre néglige les innovations des populations de chasseurs-cueilleurs occupant la taïga sibérienne il y a 8000 ans, y compris la construction de certains des sites fortifiés les plus anciens du monde. Ici, les auteurs présentent les résultats du site fortifié d’Amnya en Sibérie occidentale, rapportant de nouvelles dates de radiocarbone comme base d’une réévaluation de l’organisation chronologique et de peuplement. Évalué dans le contexte de l’évolution du paysage social et environnemental de la taïga, Amnya et des sites fortifiés similaires peuvent être compris comme une facette d’une stratégie adaptative plus large.

 

Le plus ancien fort promontoire du monde: Amnya et l’accélération de la diversité des chasseurs-cueilleurs en Sibérie il y a 8000 ans

Publié en ligne par Cambridge University Press:  01 décembre 2023

Autorisations[ Ouvre dans une nouvelle fenêtre ]

Résumé

Les récits archéologiques ont traditionnellement associé l’essor de la complexité sociale et politique ‘ ’ à l’émergence de sociétés agricoles. Cependant, ce cadre néglige les innovations des populations de chasseurs-cueilleurs occupant la taïga sibérienne il y a 8000 ans, y compris la construction de certains des sites fortifiés les plus anciens du monde. Ici, les auteurs présentent les résultats du site fortifié d’Amnya en Sibérie occidentale, rapportant de nouvelles dates de radiocarbone comme base d’une réévaluation de l’organisation chronologique et de peuplement. Évalué dans le contexte de l’évolution du paysage social et environnemental de la taïga, Amnya et des sites fortifiés similaires peuvent être compris comme une facette d’une stratégie adaptative plus large.

TypeArticle de Recherche
Creative Commons

Licence Creative Common - CCLicence Creative Common - BY
Il s’agit d’un article Open Access, distribué sous les termes de la licence Creative Commons Attribution (https://creativecommons.org/licenses/by/4.0/), qui permet la réutilisation, la distribution et la reproduction sans restriction sur tout support, à condition que l’œuvre originale soit correctement citée.
Droit d’auteur

Copyright © Auteur(s), 2023. Publié par Cambridge University Press pour Antiquity Publications Ltd

Introduction

Les paysages boréaux subarctiques de la taïga sibérienne peuvent sembler lointains, mais c’est ici, il y a 8000 ans, que les chasseurs-cueilleurs ont construit des colonies fortifiées, plusieurs siècles avant l’apparition d’enceintes comparables en Europe (Figure 1‘). La construction de fortifications par des groupes de butineurs a été observée sporadiquement ailleurs dans le monde dans diverses régions de—principalement côtières— à partir de la préhistoire ultérieure, mais l’apparition très précoce de ce phénomène dans l’intérieur de la Sibérie occidentale est sans précédent. Ce phénomène, largement inconnu des chercheurs internationaux, peut contribuer à la réévaluation critique des récits de voies linéaires vers le changement social de plus en plus explorés dans les débats scientifiques et populaires (ex. Dan-Cohen Référence Dan-Cohen2020; Graeber & Wengrow Référence Graeber et Wengrow2021‘).

Figure 1. Régions avec des sites clos/fortifiés de chasseurs-cueilleurs et d’agriculteurs (hachés) et des traditions de poterie précoce (nuances vertes et oranges) dans le nord-ouest de l’Eurasie, septième au sixième millénaire cal BC (illustration par B. Ahrens & S. Juncker; distribution de poterie modifiée après la Jordanie et alRéférence Jordan, K., P., H. Piezonka, F. et J.2016; enclos des communautés agricoles après Müller 2010; voir OSM pour les références).

Établissements de gîtes avec enclos composés de banques, de fossés et/ou/ou palissades apparaissent sur les promontoires et autres sommets topographiques à travers la plaine de Sibérie occidentale à partir de la fin du septième millénaire cal BC (Borzunov Référence Borzunov2020; Dubovtseva et alRéférence Dubovtseva, Kosinskaya, Piezonka et Chairkina2020; Schreiber et alRéférence Schreiber, Piezonka, Chairkina, Dubovtseva, Kosinskaya, Ibsen, Ilves, Maixner, Messal et Schneewei ⁇2022; voir matériel supplémentaire en ligne (OSM)). Ces colonies complexes font partie d’un ensemble plus large d’innovations et de transformations socio-économiques et technologiques en Sibérie occidentale et délimitent ainsi une phase de changement social accéléré qui n’est que partiellement comprise. Ici, nous présentons de nouveaux résultats du site clé d’Amnya, qui fait partie de notre programme systématique de recherche en cours (Dubovtseva et alRéférence Dubovtseva, Kosinskaya, Piezonka et Chairkina2020; Chairkina et Piezonka Référence Chairkina et Piezonka2021; Schreiber et alRéférence Schreiber, Piezonka, Chairkina, Dubovtseva, Kosinskaya, Ibsen, Ilves, Maixner, Messal et Schneewei ⁇2022‘). En contextualisant de nouvelles données chronologiques et des preuves structurelles des caractéristiques architecturales et de la disposition de ce complexe, les, nous avons proposé divers scénarios qui pourraient expliquer l’émergence soudaine et sans précédent de mondes de vie diversifiés de chasseurs-cueilleurs dans la taïga de Sibérie occidentale il y a 8000 ans.

Territorialité, diversification sociale et fortification dans les sociétés de chasseurs-cueilleurs

Dans les récits archéologiques occidentaux, explicitement ou implicitement enracinés dans la pensée évolutionniste, la transition vers l’agriculture est souvent considérée comme fondamentale pour la ‘complexité’ (Arnold et alRéférence Arnold, Sunell, Nigra, Bishop, Jones and Bongers2016). Les définitions archéologiques de la complexité sociale varient considérablement, car les critères clés utilisés pour définir ce qui est considéré comme ‘ complexe ’ sont incohérents dans toute la discipline. Diverses combinaisons de traits tels que le sédentisme, les densités de population élevées, les économies excédentaires, les hiérarchies sociales émergentes et le leadership héréditaire, la guerre et la construction de fortifications sont généralement associées au concept de complexité sociale ( Dan-Cohen Référence Dan-Cohen2020‘). Dans cet article, nous évitons délibérément le terme ‘(social) complexity’ car il évoque une notion évolutionniste du changement dans les sociétés humaines et, au contraire, dans les sociétés humaines, nous abordons la dynamique sociétale observée comme ‘diversification’. Par diversification, nous nous référons au contexte sociétal de l’hétérogénéité accrue, exprimée par de nouvelles pratiques matérielles telles que la production de poterie et la monumentalité à la fin du septième millénaire avant JC.

La recherche sur l’architecture défensive relève traditionnellement des études sur les sociétés agricoles, préétatiques et étatiques (ex. Ballmer et alRéférence Ballmer, Fernández-Götz et Mielke2018‘). Les comptes rendus de comportement défensif dans les sociétés non agricoles sont relativement rares, et le sujet reste largement absent des manuels récents sur les chasseurs-cueilleurs et sur l’archéologie des conflits (p. ex. Cummings et alRéférence Cummings, Jordan et Zvelebil2014; Fernández-Götz et Roymans Référence Fernández-Götz et Roymans2018‘). C’est principalement dans les Amériques que les enquêtes sur l’architecture défensive des chasseurs-cueilleurs ont progressé, laissant de plus en plus de cadres (néo-)évolutionnistes et comportementalistes et, au lieu de cela, se concentrant sur l’économie politique, les approches anarchistes et post-humanistes (par ex. Angelbeck Référence Angelbeck2016; Grier et alRéférence Grier, Angelbeck et McLay2017‘). Les études en langue russe, principalement descriptives-positivistes ou ethnohistoriques sur le sujet, ont jusqu’à présent reçu peu d’attention internationale (Perevalova Référence Perevalova2002; Borzounov Référence Borzunov2020‘).

Les études archéologiques et ethnographiques documentent une variété de motifs pour la construction de fortifications, en fonction non seulement de l’anticipation de la menace, mais aussi de la stratégie défensive et de la structure sociale (Clark & Bamforth Référence Clark et Bamforth2018‘). Dans les sociétés mobiles, la fortification peut être une stratégie pour prévenir le comportement imprévisible des autres, comme les raids (Golovnev et Osherenko Référence Golovnev et Osherenko1999). L’abondance fiable des ressources ( saisonnières ) et les possibilités de récolte de masse peuvent déclencher une territorialité et une appropriation accrues parmi les groupes de chasseurs-cueilleurs ( par ex. Schulting Référence Schulting et Ralph2013). Les sites permanents, par exemple les cimetières officiels du Mésolithique supérieur de plus en plus reconnus dans le nord de l’Eurasie, ont été liés à de telles revendications territoriales ( Rowley-Conwy Référence Rowley-Conwy, Zvelebil, Dennell et Domanska1998; Schulting et alSchulting de référence2022). L’architecture ostensiblement défensive, en tant que construction à long terme de l’espace, peut également avoir des fonctions parallèles, servant de repères dans la mémoire collective et l’identité ( Grier et alRéférence Grier, Angelbeck et McLay2017‘). En tant que manifestations de l’inégalité sociale, les fortifications peuvent également être liées aux droits de propriété (héritables), aux obligations du travail et à la restriction de l’accès aux ressources (par exemple. Golovnev Référence Golovnev, Schweitzer, Boesele et Hitchcock2000; Grier et alRéférence Grier, Angelbeck et McLay2017‘). Cependant, la différenciation politique croissante ne s’accompagne pas nécessairement d’une plus grande inégalité des richesses, et l’architecture défensive peut également être coordonnée sans une autorité centralisée (Angelbeck Référence Angelbeck2016; Moreau Référence Moreau2020‘).

Matériaux et méthodes

Il y a une longue histoire de fortifications de chasseurs-cueilleurs en Sibérie occidentale, allant de l’Âge de pierre jusqu’à la conquête russe de la région aux seizième et dix-septième siècles après JC. Les preuves ethnohistoriques donnent un aperçu des motifs et des stratégies de construction de ces sites défensifs (Golovnev et Osherenko Référence Golovnev et Osherenko1999; Schreiber et alRéférence Schreiber, Piezonka, Chairkina, Dubovtseva, Kosinskaya, Ibsen, Ilves, Maixner, Messal et Schneewei ⁇2022‘).

Le contexte des anciennes fortifications de Sibérie occidentale

La Sibérie occidentale, entre les montagnes de l’Oural et la rivière Yenisei, représente un écosystème particulièrement riche du point de vue des chasseurs-cueilleurs et des pêcheurs. Les poissons, les oiseaux aquatiques, les oiseaux forestiers et le gros gibier comme le wapiti et le renne ont des comportements saisonniers prévisibles, et cette abondance peut avoir contribué à une augmentation de la différenciation démographique et sociopolitique une fois que les stratégies de récolte de masse de ces ressources ‘naturellement stockées’ se sont développées (Golovnev Référence Golovnev1995; Adaev Référence Adaev2007‘). Les produits durables et transportables fabriqués à partir de ces ressources naturelles pourraient inclure de l’huile de poisson, de la farine de poisson, du poisson séché/fumé, oiseaux séchés et viandes congelées—produits fabriqués et utilisés par des groupes autochtones de l’ouest de la Sibérie jusqu’à nos jours (Piezonka Référence Piezonka, Nieuwenhuyse, Bernbeck et Berghuijs2023‘). Ces ressources ‘front-chargées’, c’est-à-dire des marchandises qui sont à forte intensité de main-d’œuvre pour acquérir et traiter, mais qui peuvent être stockées et sont ensuite faciles à transporter et à préparer (Bettinger Référence Bettinger2009), aurait été une cible pour les pillards.

Les sites de chasseurs-cueilleurs pré-poteries de l’Holocène précoce (appelés ‘Mesolithic’ dans la périodisation régionale, voir OSM) sont concentrés dans la région de l’Oural et plus faiblement répartis dans les basses étendues plus à l’est. Cette dernière zone est devenue occupée plus intensivement seulement à partir de la fin du septième millénaire cal BC (régionalement appelé ‘Neolithic’ mais appelé la poterie Mésolithique dans la terminologie occidentale; voir Figure S1). Parmi ces sites pionniers figurent les premières colonies fortifiées du nord de l’Eurasie avec des preuves d’organisation hiérarchique indiquées par des fosses de tailles différentes; huit exemples d’Âges de pierre sont actuellement connus (Borzunov Référence Borzunov2020Figure 1‘). Un autre nouveau type de site qui a émergé au cours de cette période est le grand monticule stratifié (Russie kholm), avec des exemples atteignant 50m de diamètre et jusqu’à 6m de hauteur (Panina Référence Panina2011‘). Ces monticules sont caractérisés par des caractéristiques inhabituelles telles que des groupes de crânes humains, des figurines en argile, des os et des bois, des foyers et des structures post-rangée, et sont interprétés comme des sites rituels ou sacrificiels (Shorin Référence Shorin2017; Piezonka et alRéférence Piezonka2020‘). L’adoption de la technologie de la poterie par les communautés locales de chasseurs-cueilleurs est une autre nouvelle caractéristique de cette période de changement dans le septième millénaire avant JC (Chairkina & Kosinskaia Référence Chairkina, Kosinskaia, Jordan et Zvelebil2009; Piezonka et alRéférence Piezonka2020‘).

Le complexe archéologique Amnya

Amnya I est considérée comme la fortification de l’Âge de pierre la plus septentrionale connue en Eurasie et, selon les preuves actuelles, également l’un des plus anciens sites d’habitation fortifiés au monde (Morozov & Stefanov Référence Morozov et Stefanov1993; Dubovtseva et alRéférence Dubovtseva, Kosinskaya et Piezonka2019; Borzounov Référence Borzunov2020). Situé dans la taïga nord de la région du bas Ob ’, la colonie occupe une broche sablonneuse au-dessus d’une plaine inondable marécageuse (Figure 2). Les caractéristiques de surface étendues comprennent des banques et des fossés, qui entourent la pointe du promontoire, et 10 dépressions de fosse domestique (Figures 2 & 3). Dix autres fosses de la maison, situées à environ 50 m à l’est, comprennent la colonie ouverte d’Amnya II ( Stefanov Référence Stefanov et Trufanov2001).

Figure 2.Haut: vue aérienne de la rivière Amnya et promontoire; fond: plan général d’Amnya I et II, montrant l’emplacement des tranchées d’excavation et les caractéristiques visibles dans le relief de surface ( illustration par N. Golovanov, S. Krubeck & S. Juncker ).

Figure 3.Amnya I, structures en relief de surface (emplacements mis en évidence). Haut: dépression de la fosse 5; bas: ligne de défense extérieure avec berge et fossé III (photographies de E. Dubovtsev).

Les fouilles à Amnya I entre 1987 et 2000 ont identifié des palissades en bois, confirmant l’interprétation défensive de deux lignes de fortification ( fossés II et III et des caractéristiques associées ). Un autre fossé intérieur à travers la pointe du promontoire ( fossé I ) a également été découvert. Les maisons à fosse sont de plan rectangulaire et varient d’environ 13 à 41 m2 en taille, avec des profondeurs allant jusqu’à 1,8 m. La plus grande de ces maisons à fosse occupe la pointe du promontoire ( Figures 3, S2 & S3 ). Les éléments de construction, y compris la présence de cheminées centrales surélevées, ont conduit à l’interprétation de ces structures en tant que logements de longue durée ( Stefanov Référence Stefanov et Trufanov2001‘). Les preuves stratigraphiques des fosses de la maison indiquent la destruction répétée de la colonie par le feu, un phénomène également observé dans d’autres sites fermés dans la région (Borzunov Référence Borzunov2020: 355–6) et pensé pour être lié à un conflit violent.

Les restes d’environ 45 poteries ont été récupérés dans le complexe Amnya. Les formes pointues et plates sont représentées, reflétant deux traditions typologiques distinctes: un type, potentiellement légèrement plus ancien, est largement caractérisé par un ornement piqué/incisé, et l’autre par la décoration de timbre de peigne (Dubovtseva et alRéférence Dubovtseva, Kosinskaya, Piezonka et Chairkina2020Figure 4, non. 1–5). Sur certains étages de la maison, les deux types de poterie ont été trouvés ensemble, indiquant au moins une contemporanéité partielle (Dubovtseva et alRéférence Dubovtseva, Kosinskaya et Piezonka2019, voir aussi ci-dessous). Les deux types de poterie appartiennent à la phase initiale de l’expansion précoce de l’utilisation de la céramique le long des couloirs fluviaux de la Sibérie occidentale (Piezonka et alRéférence Piezonka2020‘). L’inventaire lithique se compose en grande partie de quartz, mais comprend également des artefacts en silex tels que des micro-lames et des outils et des armes en ardoise, y compris de nombreuses têtes de projectiles en ardoise (Figure 4, non. 6–10) (Dubovtseva et alRéférence Dubovtseva, Kosinskaya et Piezonka2019‘). Les fragments osseux n’ont été conservés qu’à l’état calciné, parmi lesquels le wapiti, le renne et le castor ont été identifiés (Morozov & Stefanov Référence Morozov et Stefanov1993‘).

Figure 4.Amnya I: poterie de la maison 9 (2–4) et la zone entre les fosses de la maison (1, 5) et les objets lithiques de la maison 1 (6–10) (après Stefanov et Borzunov Référence Stefanov, V.I. et Borzunov2008‘).

Quatre dates radiocarbones radiométriques des fouilles initiales ont été interprétées comme une preuve pour un précédent, Phase mésolithique du huitième millénaire de la Colombie-Britannique et phase de colonisation principale au début du sixième millénaire de la Colombie-Britannique ( voir OSM ). Des preuves de réoccupation pendant la période énéolithique du quatrième millénaire, la Colombie-Britannique, ont également été identifiées dans certaines des fosses de la maison Amnya I. Sur la base de la typologie céramique, les excavatrices ont attribué Amnya II à l’Énéolithique, bien qu’une activité antérieure ait également été considérée comme possible ( Stefanov Référence Stefanov et Trufanov2001‘). Pour affiner notre compréhension des dispositions de ces sites et de leurs séquences de construction, et à ce jour, en 2019, nous avons mené des travaux de terrain à Amnya I et II, y compris une enquête topographique, réévaluation des sections des tranchées d’excavation antérieures, datation au radiocarbone et études paléoenvironnementales et paléobotaniques. Ici, nous présentons les résultats, y compris les nouvelles dates radiocarbone pour diverses fonctionnalités à Amnya I et les premières dates directes pour Amnya II.

Résultats: structure de peuplement, chronologie et paléoenvironnement

Caractéristiques de topographie et de peuplement

L’étude topographique a permis d’obtenir un modèle 3D du complexe archéologique d’Amnya (Figure 2‘). Des sections stratigraphiques à travers les maisons 2, 4 et 8 et les lignes de fortification intérieure et extérieure à Amnya I, et à travers la maison 2 à Amnya II (Figure 2: marques rouges), a facilité une réévaluation des séquences et l’échantillonnage de spécimens stratifiés de façon sûre pour la datation au radiocarbone et les analyses paléobotaniques (Figures 5 & 6; voir aussi OSM).

Figure 5.Amnya I, tranchée 2: passage par le fossé I (unités stratigraphiques 1–9) et la structure du bâtiment 2 (unités stratigraphiques 10–19). Photo de profil rectifiée (haut) et dessin avec interprétation et position de l’échantillon (bas) (illustration par L. Kosinskaïa, N. Golovanov & S. Juncker).

Figure 6.Amnya I, tranchée 2: palissade 1 ( unité stratigraphique 6 ) et couche culturelle en cul ( unité stratigraphique 4 ). Photographie de profil rectifié ( haut ) et dessin avec interprétation et position de l’échantillon ( bas ) ( illustration par H. Piezonka, N. Golovanov & S. Juncker ).

Une chronologie révisée du complexe Amnya

Basé sur des observations stratigraphiques et planimétriques et trouve des distributions, les pelles d’origine ( Morozov & Stefanov Référence Morozov et Stefanov1993; voir également OSM ) a suggéré la séquence suivante:

  1. 1 )les caractéristiques les plus anciennes d’Amnya I sont la maison 1, le fossé I et peut-être aussi la maison 4;

  2. 2 )après le remplissage du fossé I, les structures 2 et 3 et une nouvelle ligne défensive comprenant le fossé II et une rive et une palissade adjacentes ont été érigées;

  3. 3 )les maisons 8 et 9 ont été construites;

  4. 4 )la troisième ligne de défense avec le fossé III et le rempart et la palissade adjacents ont été érigés (la palissade coupant à travers la maison 8 déjà abandonnée); maisons 5, 6 Et 7 pourraient également dater de cette phase.

Notre réévaluation de la distribution spatiale de la poterie et d’autres matériaux a conduit à une réinterprétation du développement du site (Dubovtseva et alRéférence Dubovtseva, Kosinskaya, Piezonka et Chairkina2020), suggérant que la maison 9 soit la structure la plus ancienne (contenant de la poterie avec décoration piquée/incisée uniquement), suivie des maisons 1 et 4 (avec des assemblages mixtes de poterie), et enfin construire les structures 2 et 3 (avec seulement des articles en peigne et de la poterie non ornementée). Les dates originales du radiocarbone n’excluent pas l’une ou l’autre interprétation.

Les 11 nouvelles dates AMS-radiocarbone présentées ici suggèrent maintenant une séquence différente des activités de construction à Amnya I (Tableau S1 et Figure S6) et fournissent les premières dates absolues pour Amnya II. Un modèle chronologique bayésien simple des résultats radiocarbone Amnya (Figure 7, voir également OSM ) indique deux phases d’activité: 1 ) une phase initiale de fortification à Amnya I au dernier siècle du septième millénaire avant JC ( à base de charbon de bois du fossé I et de la palissade 1 et de la matière organique de la culture associée couche ); et 2 ) la phase d’occupation principale au début du sixième millénaire avant JC ( à base de charbon de bois provenant des maisons 1, 2 et 8 à Amnya I et de la maison 2 à Amnya II ). Cela indique que le complexe néolithique primitif comprenait à la fois une colonie fortifiée sur le promontoire d’Amnya ( Amnya I ) et un complexe de maisons ouvertes largement contemporain à 50 mètres ( Amnya II; voir Figure 2). Une réoccupation œnolithique au quatrième millénaire de la Colombie-Britannique mettant en vedette des maisons mèches et une culture matérielle associée est attestée à la fois par Amnya I et II ( Stefanov Référence Stefanov et Trufanov2001) mais n’était pas soumis à de nouveaux travaux de rencontres.

Figure 7. Haut: Modèle chronologique bayésien d’activité à Amnya. Distributions dans les grandes lignes: étalonnage simple des résultats du radiocarbone à l’aide des données d’étalonnage IntCal20 ( Reimer et al. Reimer de référence2020) et OxCal v4.4 ( Bronk Ramsey Bronk Ramsey de référence2009). Distributions solides: estimations de la densité postérieure des dates des échantillons ( noir, charbon de bois; matériau végétal vert et non carbonisé ) et événements associés ( bleu ). La structure du modèle est définie par les parenthèses et les fonctions OxCal ( police à surface égale ). Centre: chronologie de l’événement ‘ 8.2ka ’ dans les carottes de glace du Groenland, basé sur Kobashi et al. (Référence Kobashi, Severinghaus, E.J., Barnola et A.M.2007), converti en cal BC. Bas: décalages temporels entre les transitions climatiques de l’événement 8.2ka et la date estimée de la palissade 1 à Amnya I (voir OSM pour les références) (figure par auteurs).

Paléoécologie et paléoenvironnement

Nous avons recueilli des échantillons pour les premières analyses de macrofossiles végétaux provenant de colonies de l’Âge de Pierre dans la taïga de Sibérie occidentale, enregistrement de la présence de plantes comestibles telles que les baies et de l’utilisation possible de brindilles de conifères comme revêtements de sol (voir tableaux S2 et S3). Les résultats du carottage des sédiments dans le marais au pied du promontoire d’Amnya (Figure 8) suggèrent que pendant son occupation de c. 6000 cal BC à partir de la période atlantique, il y avait un lac au sud du site et une rivière sur son côté nord (voir tableau S4). Trois datations au radiocarbone indiquent que des dépôts de boue lacustre (gyttja) ont commencé à se former du huitième au septième millénaire avant JC; la tourbe a commencé à se former c. 5000 cal BC, expansion pour remplacer le lac au cours du quatrième millénaire cal BC.

Figure 8.Profils sédimentaires de carottage adjacents au promontoire d’Amnya avec dates au radiocarbone (illustration par N. Chairkina & S. Juncker).

Discussion: diversité des chasseurs-cueilleurs et fluctuations environnementales?

Que s’est-il passé en Sibérie occidentale au début de l’Holocène qui a conduit à l’émergence de mondes de vie diversifiés de chasseurs-cueilleurs comportant de nouvelles colonies fermées et structurées, comme l’illustre le complexe Amnya? L’augmentation des conflits intergroupes et les raids persistants ont-ils nécessité des constructions défensives? Les moteurs communautaires ou rituels, ou les innovations techniques ont-ils conduit à de nouvelles façons de s’approprier l’espace et le paysage? Quel rôle les fluctuations climatiques et les changements environnementaux ont-ils joué dans ces évolutions? Pour aborder ces questions, il faut examiner le contexte environnemental et socioculturel plus large du phénomène.

Changement climatique et environnemental: le cadre de l’événement 8,2 ka

Les premiers sites fortifiés de l’ouest de la Sibérie sont apparus peu de temps après l’événement de refroidissement BP de 8,2 ka, l’un des changements climatiques mondiaux les plus prononcés de l’Holocène qui a duré c. 6200 – 6050 cal BC (Figure 9 & OSM ). Cet événement a coïncidé avec des manifestations d’une territorialité accrue parmi les groupes de chasseurs-cueilleurs dans d’autres parties du nord de l’Eurasie, par exemple, l’émergence de cimetières formels en Carélie russe ( Schulting et alSchulting de référence2022). En Europe et en Asie du Sud-Ouest, les adaptations des systèmes socio-économiques ont été liées à l’événement de 8,2 ka ( par ex. Clare Clare de référence2016; Roffet-Salque et alRéférence Roffet-Salque2018); en Asie du Nord, cependant, les liens potentiels entre le changement climatique et l’adaptation humaine sont encore mal compris (par exemple. Kobe et alRéférence Kobe, Bezrukova, Leipe, Shchetnikov, Goslar, Wagner, Kostrova et Tarasov2020‘). Dans l’Arctique de la Sibérie occidentale, une apparition rapide du Maximum thermique de l’Holocène au milieu du septième millénaire cal BC a été postulée (Ryabogina et alRéférence Ryabogina, Afonin, Ivanov, Li, Kalinin, Udaltsov et Nikolaenko2019), qui peut masquer l’événement de 8,2 ka. Plus au sud, dans le bassin de Sibérie occidentale, les tourbières ont commencé à se développer beaucoup plus tard, il y a seulement 6000–5000 ans (Kuvaev Référence Kuvaev2001), un scénario conforme aux résultats de notre étude pilote sur les carottes de sédiments d’Amnya (voir Figure 8 & OSM). Cependant, la compréhension des développements paléoenvironnementaux dans l’Holocène inférieur de la Sibérie occidentale reste inégale.

Figure 9. Traits économiques et culturels dans l’Holocène inférieur Sibérie occidentale dénotant une phase d’innovations c. 6000 cal BC (illustration par B. Ahrens et H. Piézonka).

Intensification économique, récolte saisonnière et aménagement des colonies

Les économies de chasseurs-cueilleurs post-glaciaires dans la zone forestière sont souvent associées à des stratégies de retour différé. Ressources “invulnérables à une exploitation excessive” (Hayden Référence Hayden, Burch et Ellanna1996: 238), par exemple le saumon ou les glands, auraient favorisé la concurrence entre les groupes de chasseurs-cueilleurs. La récolte de masse saisonnière est considérée comme une condition préalable à l’accumulation d’excédents stockables et, lorsqu’il est relié à des ressources qui peuvent être héritées et/ou monopolisées (p. ex. les sites piscicoles), la capacité d’organiser et de stocker de grandes quantités pourrait être cruciale dans le développement des inégalités de richesse et de pouvoir (Feinman & Neitzel Référence Feinman et Neitzel2023‘). Innovation technique (p. ex. techniques de capture telles que constructions stationnaires pour la pêche, armes à arc et à flèche, méthodes de conservation et de stockage, etc, et les technologies de prestige) sont également considérées comme un facteur crucial dans l’intensification socio-économique (par exemple. Angelbeck et Cameron Référence Angelbeck et Cameron2014; Jordanie Référence Jordan2015‘). La poterie, en particulier, est considérée comme un développement technique important, permettant de nouvelles stratégies de traitement et de stockage pour les aliments durables et riches en calories tels que l’huile de poisson (Craig Référence Craig2021‘). Dans la région d’étude, l’adoption de la poterie et la construction de sites fortifiés pourraient être considérées comme reflétant ces développements socio-économiques (Piezonka Référence Piezonka, Nieuwenhuyse, Bernbeck et Berghuijs2023‘).

Les preuves d’une colonisation Mésolithique tardive dans une grande partie de la région sont limitées à quelques camps éphémères, et une forte augmentation de la population est notable avec le début du Néolithique précoce c. 6000 cal BC (voir OSM). À en juger par la diversité des premiers inventaires de poterie et lithiques associés à cette période néolithique naissante, même sur des sites uniques tels que Amnya I, on présume que différentes communautés ont participé à l’augmentation de la population.

On ignore actuellement si des sites tels que Amnya étaient habités toute l’année. Alors que les études ethnographiques attestent des cycles saisonniers de mouvement dans cette région, avec des colonies d’hiver et d’été (Golovnev Référence Golovnev1995), quelques caractéristiques de Amnya I et II, tels que les pit-houses avec de grands foyers centraux (occupation hivernale) et d’épaisses couches culturelles entre les maisons (résultant d’activités dans la période sans neige), indiquent peut-être une occupation toute l’année. Nos nouveaux résultats de datation montrent que les maisons 2, 8 et 9 à Amnya I et la maison 2 à Amnya II étaient largement contemporaines. Certaines parties de l’architecture de fortification (palissade 1 et fossé I) semblent être environ 100–200 ans plus tôt que ces habitations, alors que la palissade 2 est stratigraphiquement plus tard que la maison 8 (Figure 7; OSM). Les nouvelles dates soutiennent donc la suggestion que le complexe peut avoir été structuré comme un ‘citadel’ fortifié avec un type de ‘bailey’ externe. De telles dispositions hiérarchiques peuvent également être observées à plusieurs autres sites fermés dans la région, y compris Kayukovo 1 & 2 et Imnegan 2.1 (Kardash et alRéférence Kardash, Chairkina, Dubovtseva et Piezonka2020Figure 10‘).

Figure 10.Complexes colonies de l’âge de pierre en Sibérie occidentale avec des maisons de fosse et des éléments d’enceinte (dans le sens des aiguilles d’une montre à partir de haut à gauche): Mergen 6; Amnya I & II; Imnegan 2.1; Kayukovo 1 & 2 (illustration par S. Juncker & H. Piézonka).

Territorialité, structure sociale et conflits intergroupes

En tant que marqueurs territoriaux sur les rives des rivières et des lacs, les premiers sites fortifiés de Sibérie occidentale auraient assuré l’accès à des lieux économiquement importants avec une abondance saisonnière fiable de ressources aquatiques. L’émergence autochtone de constructions monumentales, telles que les monticules rituels, les, les pit-houses et les fortifications peuvent marquer un réarrangement de l’ordre social vers la propriété et la territorialité par une différenciation accrue dans l’organisation du travail et des ressources. En sécurisant l’accès aux ressources, en valorisant les mémoires et les histoires sociales et en créant des relations sociales, les constructions monumentales auraient incarné des objectifs individuels et collectifs (Grier & Schwadron Référence Grier et Schwadron2017: 5; Feinman et Neitzel Référence Feinman et Neitzel2023‘). Alternativement, il a été suggéré que les premiers sites fortifiés de la taïga sont une adaptation à l’augmentation des conflits intergroupes. Dans ce scénario, les sites auraient été construits soit par des personnes entrantes, vraisemblablement du sud, pour assurer leur occupation de la région, ou par les populations locales qui se défendent contre ces groupes d’immigrants (Borzunov Référence Borzunov2020: 548–9; voir aussi Kosinskaya Référence Kosinskaya2002; Chairkina & Kosinskaia Référence Chairkina, Kosinskaia, Jordan et Zvelebil2009‘).

Expliquer la voie ouest de la Sibérie

Sur la base de la situation actuelle, nous proposons un modèle d’intensification économique, éventuellement combiné à un afflux de personnes d’au-delà de la région, pour expliquer les changements simultanés observés en Sibérie occidentale c. Il y a 8000 ans: la croissance démographique, l’émergence de sites fortifiés, une augmentation du nombre de colonies de maisons de fosse, la montée de la monumentalité rituelle— comme en témoignent les kholmy monds—et l’adoption de la poterie (Figure 9‘). Trois scénarios possibles concernant le rôle potentiel des changements environnementaux dans ces développements, peut-être liés à l’événement climatique de 8,2 ka, peuvent être envisagés.

Le scénario 1 suppose que l’ensemble des innovations décrites ci-dessus a été élaboré en réponse au stress économique induit par les fluctuations climatiques (p. ex. par l’évolution des régimes d’oxygène dans les plans d’eau, affectant négativement les populations de poissons), et que cela a déclenché l’ajustement des systèmes économiques et sociaux par l’innovation technologique. En revanche, le scénario 2 propose que les changements environnementaux à la suite de l’événement de 8,2 ka ont entraîné une augmentation de l’abondance et/ou de l’accessibilité de certaines ressources saisonnières. Cela a déclenché le développement de nouvelles stratégies de récolte de masse et amélioré les pratiques de stockage qui, à leur tour, ont permis l’accumulation de surplus de ressources. La gestion de ces excédents a ensuite entraîné des changements dans la structuration sociopolitique des populations et l’émergence non seulement d’inégalités de richesse et de droits de propriété exclusifs,mais aussi d’une cohésion communautaire accrue, par exemple par le travail collectif et l’utilisation de constructions monumentales. Enfin, le scénario 3 rejette un lien plus profond entre le paquet d’innovations socio-économiques et les changements environnementaux suggérant, au contraire, que des développements tels que la nouvelle pêche, l’avifaune, etc, les technologies de traitement et de stockage ont été influencées par d’autres facteurs. Ceux-ci peuvent inclure des groupes entrants, apportant des innovations avec eux, ou déclenchant le développement de telles innovations par le biais d’interactions avec les populations locales.les technologies de traitement et de stockage ont été influencées par d’autres facteurs. Ceux-ci peuvent inclure des groupes entrants, apportant des innovations avec eux, ou déclenchant le développement de telles innovations par le biais d’interactions avec les populations locales.les technologies de traitement et de stockage ont été influencées par d’autres facteurs. Ceux-ci peuvent inclure des groupes entrants, apportant des innovations avec eux, ou déclenchant le développement de telles innovations par le biais d’interactions avec les populations locales.

Conclusions: une innovation Stone Age ‘package’ dans la taïga?

La colonie fermée de chasseurs-cueilleurs d’Amnya dans la taïga sibérienne occidentale est l’un des plus anciens sites d’habitation fortifiés connus au monde. S’appuyant sur les résultats d’excavations antérieures, de nouveaux travaux de terrain et un programme connexe de datation au radiocarbone ont maintenant clarifié la date d’activité sur le site, y compris les fossés, les berges, palissades et les maisons à fosse substantielle, à Amnya I à c. 6000 cal BC. Pour la première fois, la grande contemporanéité de la colonie Amnya II adjacente à ciel ouvert a également été démontrée, indiquant une structure hiérarchique complexe du site, avec un promontoire fermé et une section extérieure non défendue associée, qui reflète les arrangements observés dans les établissements contemporains dans la région.

Amnya et les quelque huit autres forts chasseurs-cueilleurs connus de l’Âge de Pierre dans la région représentent la preuve d’une voie autochtone sans précédent vers la différenciation sociopolitique dans une partie inattendue du monde. Coïncidant avec une forte augmentation de la population, ces sites émergent dans le cadre d’un ensemble plus large de changements qui ont pris racine dans la taïga c. 6000 cal BC. Ce paquet comprenait des innovations technologiques (y compris la poterie), la subsistance, la pratique rituelle et l’organisation sociopolitique, ressemblant largement aux piliers principaux du paquet ‘Neolithic’ typiquement lié à l’expansion de l’agriculture précoce (castingiros Référence: filingiroslu2005). Cet horizon d’innovation suggère des transformations marquées dans les structures socio-politiques des populations de chasseurs-cueilleurs de l’Holocène primitif vivant dans la taïga, y compris une plus grande cohésion de groupe, un sédentisme et une territorialité accrus, et une augmentation des tensions sociales et des conflits intergroupes. Au sein de cette suite de développements, des sites fortifiés, tout en étant fonctionnellement défensifs, ont également signalé un nouvel attachement plus persistant des communautés aux lieux. Travailler à la création et à la défense de colonies fortifiées aurait permis le développement d’une unité de groupe et d’une cohésion interne plus fortes. Ces développements sont également inhérents à la kholmymonticules comme structures rituelles à grande échelle dans le paysage. Le rôle des fluctuations climatiques au cours de l’événement de 8,2 ka, et les adaptations socio-économiques possibles en réponse aux changements environnementaux associés, reste incertain.

Le complexe de colonies d’Amnya marque le début d’un phénomène unique et à long terme de sites défensifs de chasseurs-cueilleurs dans le nord de l’Eurasie, une tradition presque ininterrompue qui a continué pendant près de huit millénaires dans la période du début de la modernité (Schreiber et alRéférence Schreiber, Piezonka, Chairkina, Dubovtseva, Kosinskaya, Ibsen, Ilves, Maixner, Messal et Schneewei ⁇2022‘). Ce phénomène distingue la Sibérie occidentale des régions adjacentes telles que la région du Baïkal et l’Europe du nord-est où la territorialité croissante s’est plutôt manifestée par l’émergence de grands cimetières (par exemple. Schulting et al. Schulting de référence2022‘). Expliquer cette voie culturelle, économique et politique spécifique dans un cadre paléoécologique et culturel qui n’était pas nettement différent des autres régions à cette date, comme la plaine du nord-est de l’Europe, est actuellement difficile. Cependant, une meilleure compréhension de la voie ouest-sibérienne est essentielle pour le développement d’une compréhension plus large de la différenciation sociale précoce, de la territorialité et des conflits dans les sociétés non agricoles et peut, à son tour, agir comme une lentille à travers laquelle le changement social dans la préhistoire peut être considéré plus généralement.

Remerciements

Les auteurs tiennent à remercier feu Vladimir Stefanov ( Ekaterinburg ), l’un des premiers chercheurs enquêtant sur Amnya, pour ses conseils précieux et perspicaces. Nos remerciements vont également à l’équipe dédiée au travail sur le terrain d’Amnya en 2019, y compris les étudiants de Mikhail Khramtsov, Anna Put’makova, Nikita Golovanov, Gennadii Saukov et Kiel Bastian Breitenfeld et Wiebke Mainusch. Nous sommes également reconnaissants à Yasmin Dannath ( Institut d’archéologie pré et protohistorique, Université de Kiel, Allemagne ) pour avoir identifié les macro-restants botaniques.

Énoncé de financement

Cette recherche fait partie du programme de recherche scientifique des Académies d’Etat des Sciences pour 2013–2020, les “Cultures anciennes et médiévales de l’Oural: caractéristiques régionales dans le contexte des processus globaux” projet (numéro d’enregistrement: AAAA-A16-116040110036-1) et la mission d’Etat du Ministère de la Science et de l’Education de la Fédération de Russie “Interaction des Traditions Culturelles et Linguistiques: The Urals in the Context of the Dynamics of Historical Processes” (sujet no. FEUz-2020-0056). Des fonds ont également été fournis par le Cluster of Excellence ROOTS, Kiel et la German Research Foundation (DFG) dans le cadre de la Stratégie d’excellence de l’Allemagne (subvention no. EXC 2150–390870439).

Informations complémentaires

Pour voir les informations supplémentaires pour cet article, veuillez visiter http://doi.org/10.15184/aqy.2023.164.

Références

AdaevV.N. 2007Culture écologique traditionnelle des Khants et des NénetsTioumenVektor Buk (en russe).Google Scholar
AngelbeckB. 2016. Tranchées, remblais et palissades: paysages de terraformation pour les fortifications défensives dans le Territoire des Salish de la Côte. Document présenté au 81st Réunion annuelle de la Society for American Archaeology, Orlando, États-Unis, 610 Avril 2016.Google Scholar
AngelbeckB. & CameronI.2014Le marché faustien du changement technologique: évaluer les effets socio-économiques de la transition arc et flèche dans le passé Salish CôteJournal of Anthropological Archaeology 3693109https://doi.org/10.1016/j.jaa.2014.08.003CrossRefGoogle Scholar
ArnoldJ.E.SoleilS.NigraB.T.ÉvêqueKJ.JonesT. & BongersJ.2016Incroyance enracinée: chasseurs-cueilleurs complexes et arguments en faveur d’une pensée évolutive culturelle inclusiveJournal de la Méthode et de la Théorie Archéologique 23448–99. https://doi.org/10.1007/s10816-015-9246-yCrossRefGoogle Scholar
BallmerA.Fernández-GötzM. & MielkeD.P.2018Comprendre les anciennes fortifications: entre régionalité et connectivitéOxfordOxbowhttps://doi.org/10.2307/j.ctvh1dqkcGoogle Scholar
ParieurR.L. 2009Chasseur-cueilleur de recherche: cinq modèles simplesClinton Corners (N.-É.)Eliot Wernerhttps://doi.org/10.2307/j.ctvzgb80xCrossRefGoogle Scholar
BorzounovV.A. 2020Anciens forts de la zone forestière de l’Oural et de la Sibérie occidentale. Volume 1: Néolithique et énéolithiqueEkaterinbourgIzdatel’stvo Ural’skogo universiteta (en russe).Google Scholar
Bronk RamseyC. 2009Analyse bayésienne des datations au radiocarboneRadiocarbone 51337–60. https://doi.org/10.1017/S0033822200033865CrossRefGoogle Scholar
ClarkA.J. & BamforthD.B.2018Perspectives archéologiques sur la guerre dans les Grandes PlainesDenverUniversity Press du Coloradohttps://doi.org/10.5876/9781607326700CrossRefGoogle Scholar
ChairkinaN.M. & KosinskaïaL.L.2009Céramiques de chasseurs-cueilleurs dans l’Oural et la Sibérie occidentale, en JordanieP. & ZvélébilM. (éd.) Céramiques avant l’agriculture: dispersion de la poterie parmi les chasseurs-cueilleurs eurasiens préhistoriques209–35. Walnut Creek (AC)Côte Gauche.Google Scholar
ChairkinaN.M. & PiézonkaH.2021Le contexte écologique des innovations néolithiques précoces dans le nord de la Sibérie occidentaleJournal Historique Ural 3 (72‘): 614 (en Russe). https://doi.org/10.30759/1728-9718-2021-3(72)-6-14CrossRefGoogle Scholar
ÇilingiroğluÇ. 2005Le concept de ‘ paquet néolithique ’: compte tenu de sa signification et de son applicabilitéDocumenta Praehistorica 32113https://doi.org/10.4312/dp.32.1CrossRefGoogle Scholar
ClareL. 2016Changement de culture et continuité en Méditerranée orientale lors d’un changement climatique rapide: évaluation de la vulnérabilité des communautés néolithiques tardives à une petite période glaciaire au septième millénaire cal BC ( Kölner Studien zur Prähistorischen Archäologie Band 7 )RahdenMarie Leidorf.Google Scholar
CraigO. 2021Fermentation préhistorique, économie à retour différé et émergence de la poterieL’Anthropologie actuelle 62S233–41. https://doi.org/10.1086/716610.CrossRefGoogle Scholar
CummingsV.JordanieP. & ZvelebilM. ( ed. ) 2014Manuel d’Oxford de l’archéologie et de l’anthropologie des chasseurs-cueilleursOxfordOxford University Presshttps://doi.org/10.1093/oxfordhb/9780199551224.001.0001CrossRefGoogle Scholar
Dan-CohenT. 2020Complexité de traçage: le cas de l’archéologieAnthropologue américain 122733– 44. https://doi.org/10.1111/aman.13479CrossRefGoogle Scholar
DubovtsevaE.N.KosinskayaL.L. & PiézonkaH.2019Analyse de la culture matérielle et nouvelle datation au radiocarbone du site néolithique précoce d’Amnya ISamara Journal of Science 8149–59 (en russe). https://doi.org/10.17816/snv201982210CrossRefGoogle Scholar
DubovtsevaE.N.KosinskayaL.L.PiézonkaH. & ChairkinaN.M.2020Les colonies de type culturel Amnya dans le contexte du Néolithique précoce du nord de la Sibérie occidentaleNovossibirsk State University Bulletin, Histoire & Philologie Série 19 (7): Archéologie et Ethnographie: 94–108 (en russe). https://doi.org/10.25205/1818-7919-2020-19-7-94-108Google Scholar
FeinmanG.M. & NeitzelJ.E.2023La dynamique sociale de l’installationJournal of Anthropological Archaeology 69https://doi.org/10.1016/j.jaa.2022.101468CrossRefGoogle Scholar
Fernández-GötzM. & RoymanN. (éd.) 2018Archéologie des conflits: matérialités de la violence collective de la préhistoire à l’Antiquité tardive (Thèmes en Archéologie Contemporaine 5)OxfordRoutledgehttps://doi.org/10.4324/9781315144771Google Scholar
GolovnevUN V. 1995Cultures parlantes: traditions samoyées et ougriennesEkaterinburgUrO RAN ( en russe ).Google Scholar
GolovnevA.V. 2000Guerres et chefs parmi les Samoyèdes et les Ougriens de Sibérie occidentale, en SchweitzerP.P.BoeseleM. & HitchcockR.K. (éd.) Chasseurs et cueilleurs dans le monde moderne125–50. New York et OxfordBerghahnhttps://doi.org/10.1515/9781782381587-009Google Scholar
GolovnevA.V. & OsherenkoG.1999Survie sibérienne: les Nénets et leur histoireIthaque (NY)Cornell University Presshttps://doi.org/10.7591/9781501727221CrossRefGoogle Scholar
GraeberD. & WengrowD.2021L’aube de tout: une nouvelle histoire de l’humanitéLondresAllen Lane.Google Scholar
GrierC.AngelbeckB. & McLayE.2017Terraformation et monumentalité en tant que pratique sociale à long terme dans la région de la mer des Salish de la côte nord-ouest de l’Amérique du NordRecherche de chasseurs-cueilleurs 3107– 32. https://doi.org/10.3828/hgr.2017.7CrossRefGoogle Scholar
GrierC. & SchwadronM.2017Terrformage et monumentalité dans les sociétés de chasseurs-cueilleurs-pêcheurs: vers un cadre conceptuel et analytiqueRecherche de chasseurs-cueilleurs 338https://doi.org/10.3828/hgr.2017.2CrossRefGoogle Scholar
HaydenB. 1996Concurrence, travail et chasseurs-cueilleurs complexes, en BoucleE.S. & EllannaLJ. (éd.) Les enjeux clés de la recherche sur les chasseurs-cueilleurs223–40. OxfordBerghahn.Google Scholar
JordanieP. 2015La technologie comme condition sociale humaine: transmission culturelle entre chasseurs-cueilleursOaklandUniversity of California Presshttps://doi.org/10.1525/california/9780520276925.001.0001Google Scholar
JordanieP.K.GibbsP.HommelH. PiézonkaF.Silva & J.Steele2016Modélisation de la diffusion des technologies de la poterie à travers l’Afro-Eurasie: idées émergentes et questions de recherche futuresAntiquité 90590603https://doi.org/10.15184/aqy.2016.68CrossRefGoogle Scholar
KardashianV.O.ChairkinaN.MDubovtsevaE.N. & PiézonkaH.2020De nouvelles recherches sur la colonie fermée du Néolithique précoce Kayukovo 2 dans le nord de la Sibérie occidentaleNovossibirsk State University Bulletin, Histoire & Philologie Série 19 (7): Archéologie et Ethnographie, 109–24 (en russe). https://doi.org/10.25205/1818-7919-2020-19-7-109-124Google Scholar
KobashiT.SéveringhausJ.P.J.E.BrookBarnolaJ.-M. & A.M.Grachev2007Calendrier précis et caractérisation du changement climatique abrupt il y a 8200 ans à partir de l’air emprisonné dans la glace polaire. Quaternaire Science Reviews 261212–22. https://doi.org/10.1016/j.quascirev.2007.01.009CrossRefGoogle Scholar
KobeF.BezrukovaE.V.LeipeC.ShchetnikovUNE.GoslarT.WagnerM.KostrovaS.S. & TarasovP.E.2020La végétation holocène et l’histoire du climat en Sibérie du Baïkal reconstruites à partir des registres du pollen et de ses implications pour l’archéologieRecherche archéologique en Asie 23: 100209. https://doi.org/10.1016/j.ara.2020.100209CrossRefGoogle Scholar
KosinskayaL.L. 2002Le néolithique du nord de la Sibérie occidentale: genèse et connexionsBulletin Archéologique Tver 5215–23 (en russe).Google Scholar
KuvaevV.B. (éd.) 2001Systèmes de tourbières de Sibérie occidentale et leur importance pour l’environnementTulaGrif (en Russe).Google Scholar
MoreauL. (éd.) 2020Introduction. Inégalité sociale sans agriculture: que pouvons-nous apprendre de la façon dont les sociétés fourragères façonnent(d) l’inégalité sociale? in Inégalités sociales avant l’agriculture? Approches multidisciplinaires de l’étude de l’organisation sociale dans les sociétés préhistoriques et ethnographiques de chasseurs-cueilleurs-pêcheurs118CambridgeInstitut McDonald de Recherche Archéologique.Google Scholar
MorozovV.M. & StefanovV.I.1993Le fort d’Amnya I—la plus ancienne colonie fortifiée d’Eurasie du Nord? Questions d’archéologie dans l’Oural 21143–70 (en russe).Google Scholar
PaninaS.N. 2011Radiokarbonnye daty Ust’-vagil’skogo kholma (Dates de radiocarbone de la colline Ust’-Vagil’)Voprosy arkheologii Urala 26246–7.Google Scholar
PerevalovaV.E. 2002Guerres et migrations du nord de Khanty (basées sur des matériaux folkloriques)Bulletin Historique Ural 83658 (en Russe).Google Scholar
PiézonkaH. 2023Une vue des forêts du nord: technologies de conteneurs des chasseurs-cueilleurs boréaux, en NieuwenhuyseO.BernbeckR. & BerghuijsK. (éd.) Conteneurs de changement: anciennes technologies de conteneurs de l’est à l’ouest de l’AsieLeydeCalcaire.Google Scholar
PiézonkaH. et al. 2020L’émergence de poteries de chasseurs-cueilleurs dans l’Oural et la Sibérie occidentale: nouvelle datation et preuve d’isotopes stablesJournal of Archaeological Science 116https://doi.org/10.1016/j.jas.2020.105100CrossRefGoogle Scholar
RéimerPJ. et al. 2020La courbe d’étalonnage de l’âge du radiocarbone de l’hémisphère nord IntCal20 (0–55 cal kBP)Radiocarbone 62725–57. https://doi.org/10.1017/RDC.2020.41CrossRefGoogle Scholar
Roffet-SalqueM. et al. 2018Preuve de l’impact de l’événement climatique 8.2-kyBP sur les premiers agriculteurs du Proche-OrientActes de la National Academy of Sciences USA 1158705–9. https://doi.org/10.1073/pnas.1803607115CrossRefGoogle ScholarPubMed
Rowley-ConwyP. 1998Cimetières, saisonnalité et complexité dans l’Erteb ⁇ lle de Scandinavie méridionale, en ZvélébilM.DennellR. & DomanskaL. (éd.), Récolter la mer, cultiver la forêt: l’émergence de sociétés néolithiques dans la région de la Baltique : 193202SheffieldSheffield Academic Press.Google Scholar
RyaboginaN.E.AfonineA.S.IvanovS.N.LiH.-C.KalininP.A.UdaltsovS.N. & NikolaenkoS.A.2019Changements paléoenvironnementaux de l’Holocène reflétés dans les enregistrements de sédiments de tourbe et de lac de Sibérie occidentale: proxies géochimiques et macrofossiles végétauxQuaternaire International 5287387https://doi.org/10.1016/j.quaint.2019.04.006CrossRefGoogle Scholar
SchreiberT.PiézonkaH.ChairkinaN.DubovtsevaE. & KosinskayaL.2022Vers la territorialité et l’inégalité? Examen des fortifications préhistoriques de chasseurs-cueilleurs dans la taïga sibérienne, en IbsenT.IlveK.MaixnerB.MessalS. & SchneeweiJ. (éd.) Fortifications dans leur paysage naturel et culturel: de l’organisation de l’espace à la création du pouvoir5168BonnHabelt.Google Scholar
SchultingR. 2013Guerre sans guerriers? La nature du conflit interpersonnel avant l’émergence d’élites guerrières formalisées, dans RalphS. ( ed. ) L’archéologie de la violence: approches interdisciplinaires1936AlbanyState of New York Press.Google Scholar
SchultingR.J. et al. 2022La datation au radiocarbone du cimetière Yuzhniy Oleniy Ostrov révèle des réponses humaines complexes au stress socio-écologique lors de l’événement de refroidissement de 8,2 kaNature Écologie et Evolution 6155–62. https://doi.org/10.1038/s41559-021-01628-4CrossRefGoogle ScholarPubMed
ShorinA.F. 2017Koksharovsky Kholm et Chertova Gora, deux sanctuaires néolithiques de l’Oural et de l’ouest de la Sibérie: similitudes et différencesArchéologie, ethnologie et anthropologie de l’Eurasie 45(2): 1625 ( en russe ). https://doi.org/10.17746/1563-0110.2017.45.2.016-025CrossRefGoogle Scholar
StefanovV.I. 2001Nouveaux matériaux sur l’Énéolithique de la région de Kazym, en TrufanovA. Ya. (éd.) Matériaux sur l’archéologie de l’Ob’-Irtysh. Collection de documents scientifiques3542Surgut. (en russe).Google Scholar
Stefanov, V.I.BorzunovV.A.2008. Neoliticheskoe gorodishche Amnya I ( po materialam raskopok 1993 i 2000 gg. ) [ Fort néolithique d’Amnya I ( à base des matériaux des fouilles 1993 et 2000 ) ], à Trufanov A.Ya. ( ed. ) Barsova Gora: drevnosti taezhnogo Priob’ya [ Barsova Gora: l’antiquité du bassin de la taïga Ob ]93111Iekaterinbourg, SurgutMaison d’édition de l’Oural.Google Scholar

Classement Pisa : le niveau des élèves français dégringole

Tableau avec 4 lignes et 74 colonnes. Affiche actuellement lignes 1 à 30. Trié par ordre décroissant par colonne « Math. »
Singapour 1 575 +6
Macao (Chine) 2 552 -6
Taiwan 3 547 +16
Hong Kong (Chine) 4 540 -11
Japon 5 536 +9
Corée du Sud 6 527 +1
Estonie 7 510 -13
Suisse 8 508 -7
Canada 9 497 -15
Pays-Bas 10 493 -26
Irlande 11 492 -8
Belgique 12 489 -19
Danemark 12 489 -20
Pologne 12 489 -27
Royaume-Uni 12 489 -13
Australie 16 487 -4
Autriche 16 487 -12
Rép. Tchèque 16 487 -12
Slovènie 19 485 -24
Finlande 20 484 -23
Lettonie 21 483 -13
Suède 22 482 -20
Nouvelle-Zélande 23 479 -15
Allemagne 24 475 -25
Lituanie 24 475 -6
France 26 474 -21
Espagne 26 473 -8
Hongrie 26 473 -8
Moyenne de l’OCDE 472 -17
Portugal 29 472 -20

 

 

Comme lors des éditions précédentes, la France se situe dans la moyenne des pays de l’OCDE. Les élèves français ont en effet obtenu 474 points en mathématiques, soit juste au-dessus de la moyenne, qui s’établit à 472 points; 474 points en compréhension de l’écrit alors que la moyenne se situe à 476 points; 487 points en culture scientifique quand la moyenne pointe à 485 points.

Constat peu réjouissant. Alors même que l’Hexagone est la 7e puissance économique mondiale, elle arrive 26en mathématiques comme en culture scientifique et 29e en compréhension de l’écrit. Ses résultats sont globalement comparables à ceux de l’Allemagne, de l’Espagne, du Portugal, de la Hongrie, de l’Italie, de la Norvège ou encore de la Lituanie.

 

Tableau avec 4 lignes et 74 colonnes. Affiche actuellement lignes 1 à 30. Trié par ordre décroissant par colonne « Compréhension de l’écrit »
Singapour 1 543 -6
Japon 2 516 +12
Irlande 2 516 -2
Taiwan 4 515 +12
Corée du Sud 5 515 +1
Estonie 6 511 -12
Macao (Chine) 7 510 -15
Canada 8 507 -13
États-Unis 9 504 -1
Nouvelle-Zélande 10 501 -5
Hong Kong (Chine) 11 500 -24
Australie 12 498 -5
Royaume-Uni 13 494 -10
Finlande 14 490 -30
Danemark 15 489 -12
Pologne 15 489 -23
Rép. Tchèque 15 489 -1
Suède 18 487 -19
Suisse 19 483 -1
Italie 20 482 +6
Autriche 21 480 -4
Allemagne 22 480 -18
Belgique 23 479 -14
Portugal 24 477 -15
Norvège 24 477 -22
Moyenne de l’OCDE 476 -11
Lettonie 26 475 -4
Croatie 26 475 -4
France 28 474 -19
Espagne 28 474 ND
Tableau avec 4 lignes et 74 colonnes. Affiche actuellement lignes 1 à 30.
Singapour 1 561 +10
Japon 2 547 +18
Macao (Chine) 3 543 -1
Taiwan 4 537 +21
Corée du Sud 5 528 +9
Estonie 6 526 -4
Hong Kong (Chine) 7 520 +3
Canada 8 515 -3
Finlande 9 511 -11
Australie 10 507 +4
Irlande 11 504 +8
Nouvelle-Zélande 11 504 -4
Suisse 13 503 +8
Royaume-Uni 14 500 -5
Slovènie 15 500 -7
États-Unis 16 499 -3
Pologne 16 499 -12
Rép. Tchèque 18 498 +1
Danemark 19 494 +1
Lettonie 19 494 +7
Suède 19 494 -5
Allemagne 22 492 -11
Autriche 23 491 +1
Belgique 23 491 -8
Pays-Bas 25 488 -15
France 26 487 -6
Hongrie 27 486 +5
Espagne 28 485 +2
Moyenne de l’OCDE 28 485 -4
Lituanie 30 484 +2

 

Classement Pisa : le niveau des élèves français dégringole

  • Lien copié
Écouter cet article
00:00/08:07
Classement Pisa: les résultats catastrophiques du système éducatif français
0 seconds of 1 minute, 1 secondVolume 0%

Les résultats de cette enquête internationale de référence montrent une forte baisse dans de nombreux pays, dont la France, qui se maintient toutefois dans la moyenne de l’OCDE.

Verdict sans appel : le «choc Pisa» n’a toujours pas eu lieu en France. C’est ce que révèlent les résultats du dernier classement «Programme pour le suivi des acquis des élèves»*, publiés ce 5 décembre. Tous les trois ans, ce test international de référence mesure les compétences des élèves de 15 ans de l’OCDE (pays membres et associés) en mathématiques, en compréhension de l’écrit et en culture scientifique. Les épreuves, qui devaient initialement être réalisées en 2021, ont été décalées d’un an en raison de la pandémie de coronavirus.

Comme lors des éditions précédentes, la France se situe dans la moyenne des pays de l’OCDE. Les élèves français ont en effet obtenu 474 points en mathématiques, soit juste au-dessus de la moyenne, qui s’établit à 472 points; 474 points en compréhension de l’écrit alors que la moyenne se situe à 476 points; 487 points en culture scientifique quand la moyenne pointe à 485 points.

Constat peu réjouissant. Alors même que l’Hexagone est la 7e puissance économique mondiale, elle arrive 26en mathématiques comme en culture scientifique et 29e en compréhension de l’écrit. Ses résultats sont globalement comparables à ceux de l’Allemagne, de l’Espagne, du Portugal, de la Hongrie, de l’Italie, de la Norvège ou encore de la Lituanie.

Les pays asiatiques en tête

De Singapour au Japon, en passant par la Corée, ce sont les pays asiatiques qui caracolent une fois de plus en tête du classement et continuent de creuser l’écart. En Europe, les meilleures performances reviennent à la Suisse, l’Irlande et l’Estonie.

Cette nouvelle édition du classement Pisa est marquée par la crise du Covid-19, qui a impacté l’ouverture et le fonctionnement des établissements scolaires dans le monde à partir de 2020. L’OCDE constate ainsi «une baisse inédite des performances des élèves» depuis le premier classement Pisa, en 2000. En mathématiques, le principal domaine étudié pour ce cru 2022, les pays de l’OCDE enregistrent, en moyenne, une dégringolade de 15 points par rapport à Pisa 2018. Là où les baisses précédentes enregistrées n’avaient jamais excédé les 4 points. En France, la baisse est vertigineuse, avec 21 points perdus en mathématiques.

Même constat en compréhension de l’écrit, où les petits Français perdent 19 points, là où la baisse moyenne dans l’OCDE est de 10 points. Ces résultats sont «parmi les plus bas mesurés par l’enquête Pisa dans les trois matières en France», observe l’OCDE. Avec une trajectoire différente selon les matières : en mathématiques, les résultats avaient stagné entre 2006 et 2018, alors qu’en compréhension de l’écrit, le déclin s’était amorcé dès 2012.

La Finlande en chute libre

En termes de déclin depuis 2018, la Finlande, l’Allemagne et la Norvège font encore pire que la France. La Finlande, qui fut jadis dans le haut du classement, enregistre la plus forte chute, même si le pays scandinave continue de devancer la France. Une situation qui s’explique, selon l’OCDE, par «la plus forte diversité, aujourd’hui, dans la population finlandaise, un début de pénurie d’enseignants et un fort écart entre les garçons et les filles, à l’avantage de ces dernières».

L’Allemagne, après le «choc Pisa» des années 2000 et une remontée dans le classement, connaît un «retournement de tendance qui avait déjà commencé en 2015»«Il convient d’évoquer le fait que la proportion d’élèves issus de l’immigration en Allemagne a doublé, passant de 13 % en 2012 à 26 % en 2022, note l’OCDE. En 2022, presque un élève sur 10 en Allemagne (9%) était né dans un autre pays, ce qui implique aussi qu’il a souvent rejoint le système éducatif allemand ’en cours de route’. De manière évidente, l’Allemagne n’a pas toujours réussi à bien les intégrer dans un système fortement stratifié.»

Mais la crise sanitaire n’a pas été une fatalité pour tous. Depuis Pisa 2018, Singapour, le Japon, la Corée, l’Estonie et l’Irlande ont continué de progresser. «Singapour a beaucoup d’avance, explique-t-on à l’OCDE. Le pays a mieux résisté au Covid. Et il souffre moins de problèmes d’attractivité du métier d’enseignant, comme le Japon et la Corée.» L’Estonie, de son côté, a largement investi sur la formation des enseignants, quand l’Irlande a développé une aide personnalisée auprès des élèves.

La pénurie d’enseignants en cause en France?

Comment expliquer les performances en baisse de la France ? «Tout n’est pas imputable au Covid», résume-t-on à l’OCDE. Faut-il regarder du côté de la pénurie d’enseignants ? En 2022, 67% des élèves étaient scolarisés dans des collèges ou lycées dont le chef d’établissement déclarait un manque d’enseignants, contre 17% en 2018 ! C’est la proportion la plus élevée dans l’OCDE. L’organisation fait un lien direct entre manque de personnels et résultats des élèves.

Le «climat disciplinaire» est «très préoccupant en France, avec une très légère aggravation», souligne par ailleurs l’enquête. Ainsi, 39% des élèves déclarent que leur temps d’apprentissage est réduit car l’enseignant doit «attendre longtemps» que la classe se calme, contre 25% en moyenne dans l’OCDE. Et un élève sur deux explique qu’il y a «du bruit et du désordre dans la plupart ou dans tous les cours», contre 30% en moyenne.

La France est également l’un des pays où les élèves déclarent percevoir le moins de soutien de la part de leurs enseignants. Seuls 52% expliquent que leurs professeurs «semblent s’intéresser aux progrès de chaque élève à la plupart des cours de mathématiques», contre 63% en moyenne dans l’OCDE. Enfin, le statut social, économique et culturel des élèves «prédit toujours bien plus les résultats en France que dans d’autres pays», même si la situation ne s’est pas aggravée : en France, les élèves issus de milieux favorisés ont par exemple obtenu des résultats en mathématiques supérieurs de 113 points à ceux des élèves défavorisés, contre 94 en moyenne dans l’OCDE.

Des annonces de Gabriel Attal ce mardi

Dans la foulée de ces résultats, officiellement révélés ce mardi matin lors d’une conférence de presse au siège de l’OCDE, Gabriel Attal tiendra ce mardi après-midi une autre conférence de presse pour annoncer son «plan d’élévation du niveau général» des élèves. Début octobre, à l’occasion de la journée mondiale des enseignants, il avait lancé une mission «exigence des savoirs» visant à faire émerger des propositions afin d’«accroître le niveau des élèves de la maternelle au lycée».

Au cours de ces dernières semaines, le ministre a déjà esquissé plusieurs pistes, parmi lesquelles l’instauration de groupes de niveau au collège ou la labellisation des manuels scolaires. Il s’est également dit prêt à «revoir la question du tabou du redoublement»À ce sujet, le classement Pisa 2022 publié ce mardi montre que 10% des élèves français âgés de 15 ans avaient redoublé au moins une fois dans leur scolarité, contre 40% en 2003, «ce qui dénote un grand changement en vingt ans». Aujourd’hui, la part des redoublants en France est à peine supérieure à celle de la moyenne des pays de l’OCDE.


*Méthodologie

Pour cette édition 2022 du classement Pisa ont été tirés au sort 6770 élèves âgés de 15 ans issus de toutes les académies de France, pour la plupart scolarisés en seconde générale et technologique (64%) mais aussi en seconde professionnelle (17,9%).

Les jeunes Français, tout comme les élèves des 80 autres pays concernés, devaient répondre sur ordinateur à une série de questions fermées (QCM, vrai/faux) ou ouvertes (à réponse courte ou construite).

Comme pour chaque étude Pisa, trois domaines ont été évalués : la compréhension de l’écrit, la culture mathématique et la culture scientifique. Cette fois-ci, à l’instar de l’édition 2012, la culture mathématique était la «majeure».


 

 

 

 

 

Source : Classement Pisa : le niveau des élèves français dégringole

« Les rois ont fait la France, elle se défait sans roi. » par Tonto

SYNOPSIS ET DÉTAILS
Enfant d’ouvriers, Kevin, 17 ans, reconsidère la société et ses injustices quand son meilleur ami Elias lui parle des bienfaits de la monarchie dans son pays d’origine.

La réflexion des deux lycéens à l’occasion d’un exposé d’Histoire les confrontera à de nombreux réfractaires, mais aussi à la découverte de l’héritage réel de la Monarchie Française.

 

Le Fils d'un Roi

Le Fils d’un roi s’avère profondément moderne.

Au lieu de montrer la royauté comme un régime du passé qu’il s’agirait de restaurer dans son intégralité,

Cheyenne Carron l’envisage comme un régime d’avenir, qui rétablirait l’égalité, la liberté, la fraternité qui régnaient en France jusqu’à 1789 et que la Révolution française a bafouées, instaurant jusqu’à aujourd’hui (et jusqu’à quand ?) le règne de l’injustice, de la censure et de l’individualisme au travers d’une République, hypocrite et incapable par essence.

Ce qui fait la réussite du Fils d’un roi, ce n’est pas qu’il est un film royaliste, un film contestataire et intelligent.

Ce qui fait sa réussite, c’est qu’il réussit à capter l’âme d’un peuple, l’âme qu’un gouvernement injuste tente en vain d’étouffer.

La réussite du Fils d’un roi, c’est qu’il est un film français.

Profondément français.

Source : « Les rois ont fait la France, elle se défait sans roi. » par Tonto

 

 

 

« Ils sont venus pour tuer »: à Crépol, le récit d’une nuit de fête subitement tombée dans l’horreur

 

Des bouquets de fleurs devant la salle de réception de Crépol, dans la Drôme, le 22 novembre 2023, où Thomas est décédé le 19 novembre.

OLIVIER CHASSIGNOLE © 2019 AFP

 

 

Dans le petit village de Crépol (Drôme), un bal populaire a viré à l’horreur. Thomas, un adolescent de 16 ans a perdu la vie après une attaque à l’arme blanche. Les témoins racontent l’horreur. Les proches confient leur peine.

Source : « Ils sont venus pour tuer »: à Crépol, le récit d’une nuit de fête subitement tombée dans l’horreur

 

Des bouquets de fleurs devant la salle de réception de Crépol, dans la Drôme, le 22 novembre 2023, où Thomas est décédé le 19 novembre.

OLIVIER CHASSIGNOLE © 2019 AFP

« ILS SONT VENUS POUR TUER »: À CRÉPOL, LE RÉCIT D’UNE NUIT DE FÊTE SUBITEMENT TOMBÉE DANS L’HORREUR

Dans le petit village de Crépol (Drôme), un bal populaire a viré à l’horreur. Thomas, un adolescent de 16 ans a perdu la vie après une attaque à l’arme blanche. Les témoins racontent l’horreur. Les proches confient leur peine.

Le

Une commune marquée par le sang. Samedi 18 novembre, le petit village de Crépol dans la Drôme a accueilli quelque 350 personnes venues danser et s’amuser dans une modeste salle des fêtes.

Peu avant 2 heures du matin, « alors que la soirée s’achevait », l’insouciance a laissé place à l’effroi. Un groupe d’agresseur armé de couteaux s’en est pris aux participants. Thomas, 16 ans, y a perdu la vie.

Le drame a débuté alors que la musique avait déjà cessé de donner le rythme dans le local. Les fêtards évacuaient la salle pour prendre l’air ou rentrer chez eux. Une sortie étrangement bloquée, comme le raconte une témoin de la scène:

« Au moment de la sortie, nous avons vu d’autres (jeunes participants, NDLR) rentrer, vraiment en force, comme s’ils poussaient » pour retourner à l’intérieur de la salle.

Thomas, 16 ans - Image d'illustration
Thomas, 16 ans – Image d’illustration © BFMTV

Les personnes présentes à l’intérieur ne s’en doutaient pas, mais « une dizaine d’individus » avaient fait irruption quelques instants plus tôt. « Entre 15 et 20 personnes ont encerclé la salle des fêtes », explique au Dauphiné Libéré un ami de Thomas présent ce soir-là. Le groupe s’en est d’abord pris à un vigile posté à l’entrée.

« RIXE GÉNÉRALE »

Confronté à plusieurs agresseurs, l’agent de sécurité s’est trouvé en difficulté. Comme l’a plus tard décrit le parquet, celui-ci a rapidement demandé l’aide de « participants inscrits » et d’autres vigiles déjà présents pour encadrer la soirée.

En un instant, la situation a dégénéré en « rixe générale », des mots de Laurent de Caigny, le procureur de Valence. Dans ce chaos, de nombreux jeunes ont été agressés à l’arme blanche. Parmi les victimes, Thomas, 16 ans. L’adolescent a succombé à ses blessures alors qu’il était transporté à l’hôpital de Lyon.

« Dehors, j’ai vu mon pote se faire tuer devant moi », raconte un ami de Thomas, qui explique avoir lui-même « pris un couteau dans l’épaule ».

Au total, les secours ont pris en charge plus de 20 victimes de cette soirée cauchemardesque. Dix-sept d’entre elles souffrent de contusions consécutives à des coups, ou des éraflures plus ou moins sévères.

Deux jeunes hommes âgés de 28 ans et 23 ans ont été hospitalisés en « urgence absolue ». L’un d’eux est sorti de l’hôpital jeudi 23 novembre. La victime de 28 ans a pris la parole anonymement auprès de RTL:

« Deux, trois personnes sont arrivées sur moi et c’est là que je me suis fait planter dans le dos. Ça m’a légèrement touché le poumon, ça m’a cassé une côte ». Face à l’hémorragie qui semblait s’accélérer, il a cru voir sa fin arriver. « Je m’estime heureux d’être encore-là ».

Crépol: comment une fête de village a tourné à la tragédie
Crépol: comment une fête de village a tourné à la tragédie

17:48

« ILS AVAIENT L’INTENTION DE TUER »

Les auteurs de ces « crimes de sang » ont fui les lieux avant l’arrivée des secours. Ils ont laissé derrière eux une scène digne d’une « guerre ». « Il y avait du sang partout », raconte au Parisien Emmanuelle, une mère venue chercher son adolescent et organisatrice.

Photo d'un van ensanglanté après le drâme de Crépol dans la nuit du 18 au 19 novembre 2023.
Photo d’un van ensanglanté après le drâme de Crépol dans la nuit du 18 au 19 novembre 2023. © BFMTV

« Je vois un blessé sur une chaise à qui on fait un massage cardiaque (…) Je vais ensuite dans la cuisine et cette fois, c’est Thomas qui est par terre et qu’on essaie de sauver (…) Je n’arrêtais pas d’appeler les pompiers parce que plus le temps passait, plus on découvrait de nouveaux blessés », se remémore la mère de famille, frappée par l’émotion.

Une participante raconte avoir vu la petite salle communale transformée en « abattoir ». « Tous ceux qui rentraient blessés, on les couchait par terre, comme à la guerre, et on les soignait ». Les traces de cette barbarie sont encore visibles plusieurs dizaines d’heures après.

À l’intérieur de la salle, la panique et le chaos ont envahi les participants. « Ça criait dans tous les sens. On voyait les gens rentrer avec les t-shirts pleins de sang », raconte au Dauphiné une victime. « Certains voulaient aller se battre, d’autres nous disaient de rester à l’intérieur. Ça a créé des conflits », ajoute une autre. Dans l’instant, certains croyaient vivre un attentat.

Pour l’une de ces témoins, tout porte à croire qu’il s’agit d’un acte volontaire et calculé:

« Ce n’est pas une rixe, ils sont venus pour tuer. Ils avaient l’intention de tuer (…) Ils avaient des couteaux d’au moins 20 à 25cm de long. On ne vient pas en soirée avec des couteaux, accuse la participante. S’il n’y avait pas eu ces vigiles, peut-être qu’on ne serait plus là pour raconter quoi que ce soit ».

« La salle ressemblait à un abattoir »: Une participante à la fête qui a tourné au drame à Crépol témoigne sur BFMTV

À ce stade, l’hypothèse d’un simple dérapage semble peu plausible. « Un élément recueilli permet d’envisager que cette expédition n’est pas simplement justifiée par la volonté ‘d’aller au bal’ à Crépol », assurait dimanche une source judiciaire à BFMTV.

Certains voisins immédiats de la salle des fêtes ont été réveillés par l’agitation. « Tout s’est passé très vite (…) Au début, j’ai cru que c’était une attaque terroriste », raconte une voisine à la presse locale.

« Ça dure environ 10 minutes, j’entends des cris, j’entends parler de coups de couteau, et des pleurs ensuite », témoigne un autre voisin alerté par le bruit.

Village de Crépols dans la Drôme sur Google Maps.
Village de Crépols dans la Drôme sur Google Maps. © Google Maps

« ÇA NOUS BRISE LE COEUR »

Dimanche matin, Crépol s’est réveillé sous le choc, traumatisé par une histoire qui rompt avec la quiétude ordinaire. « Pour tous les jeunes présents, ce qui devait être un moment de fête a finalement été le mouroir de leur insouciance juvénile », regrette la députée Emmanuelle Anthoune, élue dans cette circonscription.

Une vie a été prise, des centaines sont marquées à vies. Les camarades de classe de Thomas, qu’ils aient été présent sur place ou non, se disent sous le choc. « C’est émouvant, touchant, ça nous brise un peu le cœur », expliquaient à BFMTV Mégane et Manon, deux adolescentes qui connaissaient le jeune garçon.

« Il était en même temps le gars qui réconciliait tout le monde quand il y avait un petit conflit dans le groupe. C’était celui qui faisait rire tout le monde », décrit Matteo, un ami et camarade de classe de Thomas.

Drôme: le village de Crépol sous le choc avec la rixe qui a causé la mort d’un adolescent de 16 ans

Pour la mère de Thomas, la douleur de cette perte est terrible. Dans un entretien à Paris Match, elle a décrit son fils comme « un jeune homme plein de vie, très aimé de ses amis, quelqu’un sans problème, très sage ». Un adolescent loin d’être bagarreur. Le frère de Thomas, âgé de 23 ans, était aussi présent ce soir-là. Il est traumatisé.

L’émotion est également très vive au club de rugby où jouait la victime. Un hommage lui a été rendu dimanche par l’organisation qui a dénoncé « la barbarie et la tragédie » de cette situation.

« ÇA NE LE FERA PAS REVENIR »

À Crépol, la stupeur a laissé place au deuil. Rapidement, il a été question d’une marche blanche en l’honneur de Thomas. Mercredi 22 novembre, trois jours après les faits, 6.000 personnes se sont rassemblées à Romans-sur-Isère pour un dernier hommage.

Des camarades de classe, compagnons de mêlées ou anonymes compatissants ont traversé la ville entre le lycée du jeune homme et le stade de rugby où joue son club. Une marche silencieuse. Plutôt que des paroles, les sentiments étaient couchés sur de grandes banderoles.

« Thomas, à jamais dans nos coeurs. On t’aime ». « On ne t’oublie pas ». Une pensée pour Thomas, pour sa famille ».

La marche blanche pour rendre hommage à Thomas, à Romans-sur-Isère, dans la Drôme, le 22 novembre 2023
La marche blanche pour rendre hommage à Thomas, à Romans-sur-Isère, dans la Drôme, le 22 novembre 2023 © OLIVIER CHASSIGNOLE © 2019 AFP

Des messages de chagrin et de soutien portés dans les rues par des manifestants visiblement marqués ou en deuil.

Banderole en hommage à Thomas, à Romans-sur-Isère, le 22 novembre 2023.
Banderole en hommage à Thomas, à Romans-sur-Isère, le 22 novembre 2023. © OLIVIER CHASSIGNOLE / AFP

En fin de parcours, un lâcher de ballons et de longs applaudissements ont rompu le silence pesant de la marche. Ce jour-là, les parents et les frères du jeune homme ne se sont pas exprimés. « Ils sont très attristés », confiait un couple d’ami à notre caméra.

Audrey, une connaissance des parents de Thomas a reconnu qu’une telle marche a pu servir à faire « passer un message fort » de soutien aux proches. « Ça ne le fera pas revenir », s’est-elle émue. « Ça aurait pu être mes enfants, ils ont à peu près le même âge ».

RÉCUPÉRATION POLITIQUE

Cette marche silencieuse aurait pu être l’occasion pour des hommes ou des femmes politiques de s’exprimer. Pourtant, dans le cortège, les écharpes tricolores étaient absentes. La volonté d’une marche « apolitique » a été respectée.

Une discrétion qui tranche avec les volontés de récupération dès dimanche. L’extrême droite a vu dans le drame de Crépol une « guerre ethnique », des mots de Marion Maréchal, tête de liste Reconquête en vue des européennes.

« À chaque fois qu’on a un événement comme celui-là, l’extrême droite se jette sur le sang des victimes comme la vérole sur le bas clergé et je trouve ça profondément répugnant”, a rétorqué le sénateur communiste Ian Brossat.

Mardi à l’Assemblée puis mercredi au Sénat, les membres du gouvernement ont été tenus de rendre des comptes. En premier lieu, Gérald Darmanin, le ministre de l’Intérieur:

« Permettez-moi, au nom du gouvernement, d’adresser mes condoléances à la famille mais aussi aux blessés. Évidemment, ce qu’il s’est passé est absolument ignoble, inacceptable. (…) Je peux vous annoncer qu’il y a quelques minutes, 7 interpellations ont été faites par la gendarmerie nationale au niveau de Toulouse ».

Drame de Crépol: « 7 personnes ont été interpellées » annonce Gérald Darmanin à l’Assemblée nationale

Au total, 9 personnes ont été appréhendées par les forces de l’ordre et placées en garde à vue. Parmi elles, les gendarmes ont identifié l’auteur accusé d’avoir porté le coup fatal. Selon le parquet de Valence, l’auteur est un jeune Français de 20 ans, déjà condamné deux fois par le passé, dont une fois pour port d’arme blanche.

ENQUÊTE, JUSTICE, RECUEILLEMENT

L’auteur potentiel était connu de la justice. L’institution est déjà attaquée pour son laxisme avant même que les chefs d’accusation ne soient officiellement adressés. Pourtant, Éric Dupond-Moretti, le deuxième ministre à entrer dans l’arène, cette fois face au Sénat, a déjà assuré la fermeté de son administration.

« Je veux vous dire que le ministère de la Justice, c’est celui des victimes. Les auteurs seront châtiés par une cour d’Assises composée de Français comme vous et moi », a répondu Éric Dupont-Moretti à la sénatrice de l’Ardèche Anne Ventalon.

La cheffe du gouvernement Élisabeth Borne s’est-elle aussi impliquée. « Les auteurs et leurs complices devront répondre de leurs actes. Aujourd’hui, l’heure est à l’enquête et au recueillement. (…) Je suis convaincue que ce moment appelle à la retenue à la décence ».

Drame singulier ou problématique de société? La Première ministre a accusé une partie de la classe politique de récupérer la mort de Thomas « pour jouer sur les peurs ». En même temps, elle a concédé que « ce drame soulève des questions plus large ».

Le travail des forces de l’ordre se poursuit. Celui de la justice se prépare. Pour la famille de Thomas, l’heure est au deuil. Son enterrement a lieu ce vendredi 24 novembre à 10h.

DOSSIER : 

ADOLESCENT TUÉ À CRÉPOL, DANS LA DRÔME

Tom Kerkour

 

 

En supprimant les péages sur l’A13 et l’A14, les automobilistes vont gagner 30 minutes sur certains trajets !

30 minutes de gagnées

Autoroute © Adobe Stock

Une autoroute en France © Adobe Stock

 

Au total, ce sont 120 millions d’euros qui vont être investis dans ce projet, une enveloppe financée pour un tiers par une augmentation de 0,22% des tarifs sur les trois années à venir.

Les premiers sites seront déployés l’an prochain, et l’ensemble du système devrait être en place en 2027.

D’après la Sanef, les autoroutes, une fois complètement en flux libre, devraient permettre des trajets beaucoup plus rapides, en supprimant les ralentissements et les arrêts entraînés par les péages.

Un parcours Paris-Caen en week-end pourrait ainsi être effectué 30 minutes plus rapidement.

 

Mais attention, si ce système apparaît très attrayant à première vue, il pourrait aussi être piégeux.

Car si l’automobiliste porteur d’un badge de péage n’aura rien à faire, les autres ne devront pas oublier qu’il ne s’agit pas d’un axe gratuit.

Ils auront soit le choix de s’inscrire sur le site de la Sanef, soit de payer leur dû dans les 72 heures. S’ils ne le font pas, ils se risquent à devoir payer une amende majorité, qui pourrait aller jusqu’à 375 euros.

 

Source : Les Echos

Source : En supprimant les péages sur l’A13 et l’A14, les automobilistes vont gagner 30 minutes sur certains trajets !

Le Conseil constitutionnel recale et tacle le gouvernement, qui voulait espionner les smartphones à distance

Jeudi, le Conseil constitutionnel a retoqué l’une des mesures les plus controversées du projet de loi justice du gouvernement, qui prévoyait d’activer à distance l’enregistrement audio et vidéo des téléphones portables de personnes visées par une action en justice.

 

Conseil constitutionnel © Vernerie Yann / Shutterstock.com

Le Conseil constitutionnel © Vernerie Yann / Shutterstock.com

 

 

Le Conseil constitutionnel a rejeté, jeudi 16 novembre, une mesure clé du projet de loi justice du gouvernement, porté par le Garde des Sceaux Éric Dupond-Moretti. La disposition, qui devait permettre l’activation à distance des smartphones dans le cadre de certaines enquêtes, a été balayée par les sages. En revanche, ces derniers ont validé l’espionnage du téléphone portable pour la géolocalisation dans certains cas.

Source : Le Conseil constitutionnel recale et tacle le gouvernement, qui voulait espionner les smartphones à distance

Covid-19 : le variant « Pirola est forcément plus transmissible que les autres » – L’Express

Image

La France est le hotspot de l’émergence du nouveau variant BA.2.86.1 (JN.1) avec un développement rapide en Île-de-France. La faiblesse de la surveillance et du séquençage dans le monde doit rendre prudent sur la situation réelle. Pas de virulence accrue rapportée. #COVID19

 

Tout d’abord, le port du masque de type FFP2. Les personnes symptomatiques doivent porter des masques pour éviter de contaminer leur entourage. Il a été prouvé qu’une personne positive qui porte un masque au moins 50 % de son temps à l’intérieur de son foyer, et fait chambre à part, diminue de 80 % la contagion dans le foyer. Pour les personnes qui n’ont pas de symptômes, elles devraient également en porter en intérieur.Il faudrait, par ailleurs, insister sur l’importance de la ventilation et mettre des capteurs de CO2 dans les pièces fermées, de sorte que nous soyons toujours en dessous des 800 parties par million (PPM) de concentration de CO2. Sinon, il faut porter un masque. Dans les transports en commun, les écoles, et bureaux partagés, on est souvent au-dessus de 800 PPM.

Source : Covid-19 : le variant « Pirola est forcément plus transmissible que les autres » – L’Express

SARS-CoV-2 infection triggers pro-atherogenic inflammatory responses in human coronary vessels | Nature Cardiovascular Research

Le SRAS-CoV-2 peut déclencher des complications cardiovasculaires aiguës. Ici, la lumière du vaisseau est obstruée par les plaques de graisse. © Rasi, Adobe Stock

Notre étude fournit des preuves de la présence du SRAS-CoV-2 dans le système vasculaire coronarien humain et démontre un tropisme viral pour les macrophages des lésions vasculaires chez les personnes atteintes de COVID-19 sévère. Nous avons trouvé des preuves de réplication du SRAS-CoV-2 dans tous les coronaires d’autopsie humaine analysés, quelle que soit leur classification pathologique, bien que la réplication virale ait été la plus élevée dans les lésions coronariennes PIT — les lésions précoces qui progressent vers des plaques athérosclérotiques plus avancées11,12. Il est bien établi que, à mesure que les lésions progressent vers des stades plus avancés, tels que les fibroathéromes et les plaques fibrocalciques, les macrophages et les cellules moussantes deviennent dysfonctionnels en raison d’une exposition prolongée aux lipides et d’un microenvironnement inflammatoire11,12. Dans les lésions PIT précoces, les macrophages qui tentent d’éliminer les lipides inflammatoires (par exemple, les oxLDL) accumulent un excès de cholestérol et de triglycérides dans les gouttelettes lipidiques cytoplasmiques12 peut être plus sujet aux infections virales. Le SRAS-CoV-2 a montré un tropisme plus fort pour les lésions artérielles que la graisse périvasculaire correspondante, qui était liée au degré d’infiltration des macrophages, compatible avec la réplication virale plus élevée dans les lésions PIT et les fibroathéromes, où les macrophages sont plus répandus. D’autres ont déjà signalé la présence d’ARNv du SRAS-CoV-2 dans le cœur et l’aorte ainsi que dans d’autres organes distants8,14,59,60. Nos données démontrent de manière concluante que le SRAS-CoV-2 est capable d’infecter et de reproduire dans les macrophages dans le vasculature coronaire des patients atteints de COVID-19. De plus, le SRAS-CoV-2 se reproduit préférentiellement dans les cellules en mousse par rapport à d’autres macrophages, en raison d’une réponse IFN réduite de type I qui conduit à l’ARNV et à l’accumulation de protéines virales, suggérant que ces cellules pourraient servir de réservoir de débris viraux du SRAS-CoV-2 dans la plaque athérosclérotique. Nos résultats démontrent que, bien que la réponse IFN de type I soit restée élevée dans les macrophages infectés par le SRAS-CoV-2, indiquant un état antiviral soutenu, les cellules en mousse infectées ne présentaient qu’une expression transitoire de l’expression du gène IFN de type I. Associé à l’expression réduite de gènes lysosomaux et à une réponse inflammatoire plus faible à l’infection par le SRAS-CoV-2,la réduction de l’IFN de type I peut contribuer à la persistance du SRAS-CoV-2 observée dans les spécimens d’autopsie athéroscléreuse analysés. Les macrophages résidant dans le tissu vasculaire peuvent subir l’auto-renouvellement, contribuant à leur entretien à long terme61, et, dans les études de transplantation cardiaque, il a été démontré que les macrophages cardiaques ont une demi-vie de 8,8 ans62. Par conséquent, il est possible que les macrophages agissent comme des réservoirs d’ARNv SRAS-CoV-2 dans des plaques athérosclérotiques. Nous avons également identifié des VSMC infectés dans des échantillons d’autopsie coronaire. Bien que le nombre de VSMC infectés soit inférieur à celui des macrophages infectés, les VSMC ont une demi-vie de 270 – 400 d63 et peut contribuer à la persistance du SRAS-CoV-2 dans la paroi artérielle.

Source : SARS-CoV-2 infection triggers pro-atherogenic inflammatory responses in human coronary vessels | Nature Cardiovascular Research

L’infection au SRAS-CoV-2 déclenche des réponses inflammatoires pro-athérogènes dans les vaisseaux coronariens humains

Abstrait

Les patients atteints de la maladie à coronavirus 2019 (COVID-19) présentent un risque accru de complications cardiovasculaires ischémiques jusqu’à 1 an après l’infection. Bien que la réponse inflammatoire systémique à l’infection par le coronavirus 2 du syndrome respiratoire aigu sévère (SARS-CoV-2) contribue probablement à ce risque cardiovasculaire accru, on ignore si le SRAS-CoV-2 infecte directement le système vasculaire coronaire et les plaques athérosclérotiques associées. Ici, nous rapportons que l’ARN viral du SRAS-CoV-2 est détectable et se réplique dans les lésions coronaires prises à l’autopsie de cas graves de COVID-19. Le SRAS-CoV-2 ciblait les macrophages de la plaque et présentait un tropisme plus fort pour les lésions artérielles que la graisse périvasculaire adjacente, en corrélation avec les niveaux d’infiltration des macrophages. L’entrée du SRAS-CoV-2 a été augmentée dans les macrophages primaires chargés de cholestérol et dépendant, en partie, de la neuropiline-1.Le SRAS-CoV-2 a induit une réponse inflammatoire robuste dans les macrophages cultivés et les explants vasculaires athérosclérotiques humains avec sécrétion de cytokines connues pour déclencher des événements cardiovasculaires. Nos données établissent que le SRAS-CoV-2 infecte les vaisseaux coronaires, induisant une inflammation de la plaque qui pourrait déclencher des complications cardiovasculaires aiguës et augmenter le risque cardiovasculaire à long terme.

Principal

La maladie à coronavirus 2019 (COVID-19), causée par le coronavirus 2 du syndrome respiratoire aigu sévère (SARS-CoV-2), est uniquement marquée par un tropisme tissulaire extraordinaire et un éventail de présentations cliniques, de l’infection asymptomatique à la détresse respiratoire aiguë, à l’insuffisance multiviscérale et à la mort1. Événements cardiovasculaires ischémiques, tels que l’infarctus aigu du myocarde (AMI) et accident vasculaire cérébral, en raison de la perturbation sous-jacente d’une plaque athéroscléreuse enflammée de façon chronique2, sont établies les complications cliniques de COVID-19 (réfs. 1,3‘). L’AMI et l’accident vasculaire cérébral peuvent être déclenchés par plusieurs infections virales respiratoires aiguës, y compris le virus de la grippe4. Cependant, les patients atteints de COVID-19 sont > 7 fois plus susceptibles d’avoir un AVC que les patients atteints de grippe5, et leur risque d’AMI et d’AVC reste élevé jusqu’à 1 an après l’infection6. La réponse inflammatoire extrême qui se produit dans les cas graves de COVID-19, également connu sous le nom de tempête de cytokines7, contribue probablement à l’augmentation du risque d’AMI et d’AVC. Cependant, la possibilité que le SRAS-CoV-2 affecte directement le vasculature coronaire, comme documenté pour d’autres organes éloignés ( par exemple, rein, intestin, cerveau, tissu adipeux et myocarde )8, reste largement inexploré. Dans les poumons, les lésions tissulaires sont aggravées par une puissante activation inflammasomique dans les macrophages détectant le virus SRAS-CoV-29. Une réponse similaire dans les macrophages infiltrant les vaisseaux artériels affectés par le virus pourrait augmenter l’inflammation de la plaque et le risque d’AMI et d’accident vasculaire cérébral chez les patients atteints de COVID-19. Ici, nous montrons, dans des spécimens d’autopsie coronarienne de patients atteints de COVID-19, que les macrophages infiltrants ont été infectés par le SRAS-CoV-2. Les macrophages chargés de lipides (cellules de mousse), une caractéristique de l’athérosclérose à tous les stades de la maladie10, étaient plus sensibles à l’infection par le SRAS-CoV-2 que les autres macrophages, et cela dépendait du récepteur neuropiline-1 (NRP-1). Le SRAS-CoV-2 a induit une forte réponse inflammatoire pro-athérogène dans les macrophages et les cellules de mousse, qui a été largement récapitulée dans une infection ex vivo du SRAS-CoV-2 d’explants vasculaires humains. Cette réponse peut contribuer aux complications cardiovasculaires ischémiques chez les patients atteints de COVID-19.

L’IA spatiale détecte l’ARN du SRAS-CoV-2 dans les macrophages coronaires

Nous avons analysé les échantillons d’autopsie coronaire (n = 27 ) de huit patients avec RT – Diagnostic confirmé par PCR de COVID-19 entre mai 2020 et mai 2021. Des données démographiques et des caractéristiques cliniques, y compris des antécédents médicaux, des facteurs de risque cardiovasculaires et d’autres informations cliniques pertinentes, ont été obtenues auprès des patients ’ dossiers médicaux électroniques et rapports d’autopsie ( IRB i21-01587 ) ( Fig. 1a et tableaux supplémentaires 1 et 2). L’âge moyen était de 69,6 ans ( médiane, 71 ans; 59 – 84 ) et 75% des patients étaient des hommes ( 6/8 ). Les patients avaient une maladie coronarienne ( 8/8 ); trois facteurs de risque cardiovasculaire ou plus, tels que l’hypertension ( 8/8 ), le surpoids ou l’obésité ( 7/8 ), l’hyperlipidémie ( 7/8 ), diabète de type 2 ( 6/8 ) et maladie rénale chronique ( 4/8 ); et certains avaient des antécédents d’infarctus du myocarde ( 1/8 ) ou d’AVC ischémique ( 1/8 ) Fig. 1a et tableau supplémentaire 1). Une ischémie myocardique aiguë a été diagnostiquée lors de l’hospitalisation chez trois patients; un patient a développé un AVC; et quatre patients ont présenté une sténose coronarienne ( > 50% ) lors de l’autopsie. Les patients, à l’exception de celui qui a été déclaré mort avant l’admission, ont été hospitalisés pour une moyenne de 17,6 d (, 8 – 31 ) ( Tableau supplémentaire 2). Un patient ( Pt. 1 ) a été hospitalisé trois fois ( pour un total de 31 d ) après le premier diagnostic. Pt. 1 a développé AMI et est décédé lors de la troisième hospitalisation, environ 140 d après avoir été testé négatif pour COVID-19 ( Fig. 1a et tableau supplémentaire 2). La présentation clinique, le cours à l’hôpital de la maladie, les traitements COVID-19 ainsi que la pathologie d’autopsie macroscopique et microscopique obtenue à partir des dossiers médicaux de l’hôpital et des rapports d’autopsie sont résumés dans le tableau supplémentaire 2.

Fig. 1: L’ARNv SRAS-CoV-2 dans les artères coronaires humaines de personnes décédées avec COVID-19 est identifié à l’aide d’une analyse spatiale basée sur l’IA.
figure 1

un, Carte thermique catégorique des échantillons d’autopsie coronaire (n = 27 ) de personnes décédées avec COVID-19 (n = 8 ) affiche leur classification du sexe, de l’âge et de la pathologie en AIT, PIT, plaques fibrocalcifiques et fibroathéromes. L’historique clinique de chaque patient est montré. Résumé des manifestations cardiovasculaires aiguës ( CV ) pendant la progression de la maladie COVID-19, sténose coronaire ( non: < 50%; oui: > 50% ), la durée de l’hospitalisation et le délai de décès après le diagnostic de COVID-19 sont également représentés. Numéros de copie d’ARN de l’ARNv antisens S et S normalisé en zone graisse vasculaire et périvasculaire ( mm2) sont affichés. NE, pas évalué. b, Images représentatives d’échantillons coronaires colorés avec coloration H&E et CD68 pour chaque classification pathologique. c, Images représentatives de l’analyse in situ basée sur l’IA RNA-FISH. Après des annotations semi-automatiques, un réseau neuronal basé sur l’IA a été utilisé pour classer le vasculature ( jaune ) et la graisse périvasculaire ( vert ). Le fond et les artefacts ( rouge ) ont été supprimés de l’analyse. Ensuite, l’analyse du classificateur de segmentation des noyaux et la quantification de l’ARN ont été effectuées en utilisant l’IA HALO et le flux de travail d’analyse spatiale. d, Images représentatives de l’analyse spatiale montrant l’emplacement de CD68 ARN, SRAS-CoV-2 S+ ou S antisense+ cellules et CD68+ Cellules à double positif à l’ARN SRAS-CoV-2. e, Diagrammes en barres montrant des copies totales de l’ARNv SARS-CoV-2 de l’antisens S et S normalisées par zone tissulaire (mm2) dans AIT (n = 4), FOSSE (n = 5), fibrocalciques (n = 8) et fibroathérome (n = 3) échantillons coronaires. f, Parcelles de barres montrant le total CD68+ SARS-CoV-2 S+ ou S antisens+ cellules dans les régions graisseuses vasculaires ou périvasculaires normalisées par zone tissulaire (mm2) dans AIT (n = 4), FOSSE (n = 5), fibrocalciques (n = 10) et fibroathérome (n = 3) échantillons coronaires. Une analyse statistique à sens unique de la variance (ANOVA) avec un test de Tukey’s post hoc pour des comparaisons multiples a été effectuée. g, SARS-CoV-2 S et S quantification antisens dans la graisse vasculaire et périvasculaire normalisée par la zone de tissu (mm2‘). Un test de rang signé de paires appariées Wilcoxon a été effectué (n = 20 par groupe). h, Images représentatives de SARS-CoV-2 NP, CD68 et fusionner dans les coronaires humains. La flèche blanche indique CD68+ SARS-CoV-2 NP+ la cellule et la flèche jaune indiquent CD68+ cellule. Pt., patient.

Des sections d’artères coronaires de toutes les autopsies ont été colorées avec de l’hématoxyline et de l’éosine ( H&E ) et classées par un pathologiste cardiovasculaire clinique ( N.N. ) comme épaississement adaptatif intimal ( AIT; n = 4 ), épaississement pathologique intimal avec infiltration de macrophages ( PIT; n = 10 ), plaque fibrocalcifique (n = 10 ) et fibroathérome (n = 3 ) ( Fig. 1a, b, Fig. D’AFFAIRES Extended. 1a, Fig. Supplémentaire. 1 et tableau supplémentaire 3) selon des critères établis11,12. Des caractéristiques pathologiques détaillées, y compris la présence de pool lipidique, de noyau nécrotique et d’inflammation adventielle, ont été notées (Données étendues Fig. 1a‘). Salissure immunohistochimique (IHC) pour CD68+ les cellules ont montré que CD68+ la numération cellulaire et les fréquences n’étaient pas significativement différentes chez les PIT, les lésions fibrocalcifiques et les fibroathéromes, alors qu’une plus grande surface colorée positive correspondant aux noyaux nécrotiques était observée chez les fibroathéromes (Fig. 1b, Données Extended Fig. 1b, c et Table Supplémentaire 3‘).

Identifier l’ARN viral SRAS-CoV-2 ( vRNA ) dans le vasculature coronaire autoptique des patients atteints de COVID-19, nous avons effectué une analyse par fluorescence d’ARN par hybridation in situ ( ARN-FISH ) pour l’ARNv codant pour la protéine de pointe ( S ). Pour établir si le SRAS-CoV-2 a infecté le vasculature coronaire humain, nous avons également sondé le brin antisens du gène S (S antisense), qui n’est produit que pendant la réplication virale. Une sonde CD68 a été utilisée pour identifier les macrophages infiltrant les vaisseaux coronaires dans les mêmes sections et établir la localisation cellulaire de l’ARNv SRS-CoV-2. Étant donné la capacité du SRAS-CoV-2 à infecter les dépôts graisseux et à accumuler de l’ARNV dans le tissu adipeux pour déclencher une forte réponse pro-inflammatoire13,14, nous avons utilisé une approche d’intelligence artificielle de réseau neuronal ( AI ) pour classer la paroi artérielle coronaire et la graisse périvasculaire dans chaque échantillon et segmentation des noyaux pour quantifier les sondes d’ARNscope dans les cellules infiltrant les deux tissus ( Fig. 1c, d). Dans la paroi artérielle coronaire, l’ARNv codant pour la protéine S et le brin antisens du gène S ont été détectés à différents degrés dans toutes les sections de tous les patients, indiquant la présence d’ARNV et l’activité réplicative du virus. Le numéro de copie du gène SRAS-CoV-2 S était similaire dans les lésions coronariennes de l’IA, du PIT, du fibrocalcifique et du fibroathérome ( Fig. 1e). Cependant, les coronaires PIT ont montré un nombre de copies significativement plus élevé du brin antisens du gène S (S antisense), indiquant une réplication virale plus élevée dans la paroi vasculaire de ces lésions (Fig. 1e‘). En particulier, CD68+ les cellules exprimant à la fois le SRAS-CoV-2 S et le brin antisens de S étaient significativement plus élevées dans le système vasculaire des coronaires PIT par rapport à d’autres pathologies (Fig. 1f‘). Dans la graisse périvasculaire, l’ARNv codant pour la protéine S a été détecté dans 20 des 21 sections, et l’antisens S a été détecté dans 19 des 21 sections (Fig. 1a‘). Dans l’ensemble, chaque patient a présenté au moins une section positive pour le VRNA antisens S et S (Fig. 1ae, f‘). Notamment, la quantité d’ARNv des brins antisens S et S était significativement plus faible dans la graisse périvasculaire que dans la paroi artérielle correspondante dans tous les échantillons (Fig. 1g‘). L’accumulation de protéines virales dans les coronaires a été confirmée par immunofluorescence (Fig. 1h‘).

Lésions artérielles PIT, qui semblaient plus sensibles à l’infection par le SRAS-CoV-2, contient significativement plus de cellules que les autres types de lésions et 4,8 fois plus de cellules que le tissu périvasculaire correspondant (2 691,8 ± 288,7 versus 697,6 ± 159,3 cellules par mm2P < 0,0001) (Données étendues Fig. 1d‘). Le nombre d’ARN CD68+ les cellules du système vasculaire coronaire étaient significativement plus élevées dans les PIT et les fibroathéromes que dans les autres lésions (Données étendues Fig. 1e), ce qui correspond à un nombre plus élevé d’ARN CD68+ cellules dans la graisse périvasculaire des lésions PIT que les lésions fibrocalcifiques et similaires aux fibroathéromes (Données étendues Fig. 1e), suggérant un rôle contributif de l’infection directe des macrophages dans la sensibilité coronaire à l’infection par le SRAS-CoV-2. Cette possibilité a été suggérée par la fréquence significativement plus élevée du CD68+ cellules exprimant le brin antisens S de l’ARNv dans les lésions PIT et la graisse périvasculaire correspondante ( Données étendues Fig. 1f) ainsi que l’association importante des copies d’ARNv du SRAS-CoV-2 avec numéro de copie CD68 dans la paroi artérielle et la graisse périvasculaire ( Données étendues Fig. 1g). L’accumulation d’ARNv SRAS-CoV-2 codant pour la protéine S était plus élevée dans le tissu entier et dans la paroi coronaire chez les patients atteints de COVID-19 avec des manifestations cardiovasculaires aiguës ( Données étendues Fig. 1h).

Pour étudier l’extension potentielle de l’infection au SRAS-CoV-2 à d’autres cellules, nous nous sommes concentrés sur les cellules musculaires lisses vasculaires ( VSMC ), sur la base de la distribution spatiale de la plupart des SRAS-CoV-2+ cellules à l’intérieur de la paroi artérielle des coronaires, et nous avons effectué des analyses de NAc qui ont été guidées par des analyses des ensembles de données de séquençage d’ARN monocellulaire humain et murin ( scRNA-seq ). Une analyse, utilisant des données scRNA-seq de coronaires humains malades ( Expression génétique Omnibus ( GEO ): GSE131780)15, a révélé que les VSMC expriment des niveaux de ACTA2 par rapport aux cellules myéloïdes, alors que l’expression de CD68 était spécifique aux macrophages ( Fig. Donnée étendue. 2a‘). De plus, nous avons analysé les données scRNA-seq de cellules dérivées de muscles lisses (VSMC) marquées par lignage, isolées des arches aortiques athérosclérotiques d’ApoE−/− Tomate souris16. Cette analyse a révélé que les CMLV dans les lésions athérosclérotiques n’exprimaient pas de niveaux significatifs de Cd68 et a maintenu un niveau élevé de Acta2 expression, bien que son expression ait été réduite par rapport aux conditions non-athérosclérotiques (Données étendues Fig. 2b‘). Sur la base de ces résultats, nous avons utilisé ACTA2 sonde pour identifier les VSMC et les macrophages d’origine VSMC comme ACTA2+, et nous avons inclus des sondes pour le VRNA antisens S et S dans l’analyse pour identifier ACTA2+ cellules infectées. Notamment, cette analyse a identifié S+ACTA2+ cellules et antisens+ACTA2+ cellules dans les coronaires humains ( Données étendues Fig. 2c); cependant, la médiane de la fréquence des VSMC infectés par le SRAS-CoV-2 ( ~ 0,14% ) chez la coronaire humaine était ~ 8 fois inférieure à celle des macrophages infectés ( ~ 1,2% ). Ces résultats montrent que, bien que le SRAS-CoV-2 puisse infecter les VSMC, le nombre de VSMC infectés dans les coronaires humains était inférieur au nombre de macrophages infectés. Étudier plus avant l’infection par le SRAS-CoV-2 des VSMC et des VSMC chargés de lipides, qui sont associés à l’athérosclérose17,18,19,20, nous avons infecté les VSMC de l’aorte humaine primaire, ainsi que les VSMC chargés de complexes cyclodextrine – cholestérol ( Données étendues Fig. 2d), avec l’isolat SRAS-CoV-2 USA WA1 / 2020. Environ 18% des VSMC cultivés et 13% des VSMC chargés de cholestérol étaient S+, et la fréquence de S antisense+ACTA2+ les cellules, indiquant une réplication virale, étaient ~ 2,6% ( Données étendues Fig. 2d, e). Conjugués à nos résultats in vitro, qui indiquent que plus de 79% des macrophages et plus de 90% des cellules en mousse sont S +, ainsi que la découverte que plus de 40% des deux types de cellules sont S antisense +, ces résultats montrent que, bien que le SRAS-CoV-2 puisse infecter les VSMC, les macrophages sont infectés à un taux plus élevé.

SARS-CoV-2 infection des macrophages humains et des cellules de mousse

L’accumulation de macrophages chargés de cholestérol (cellules de mousse) est une caractéristique de l’athérosclérose à tous les stades de la maladie, de la PIT précoce aux lésions du fibroathérome tardif10,12. Étudier l’infection par le SRAS-CoV-2 des macrophages et des cellules de mousse, nous avons différencié les monocytes humains dérivés de cellules mononucléées du sang périphérique humain en macrophages et les avons traités avec des lipoprotéines de basse densité oxydées (oxLDL) complexées avec un colorant Dil (Dil-Ox-LDL) pour les différencier en cellules de mousse. Pour confirmer expérimentalement notre observation que le SRAS-CoV-2 peut infecter les macrophages de la plaque humaine, les macrophages et les cellules de mousse ont été infectés soit par le virus rapporteur icSARS-CoV-2 mNeonGreen (mNG), un virus modifié qui permet l’utilisation de la fluorescence mNG comme lecture de substitution pour la réplication virale21, ou avec l’isolat SARS-CoV-2 USA WA1/2020. l’expression de mNG a confirmé la capacité du SARS-CoV-2 à se répliquer dans les deux types de cellules, bien que la réplication soit plus élevée dans les cellules en mousse (Fig. 2a et Extended Data Fig. 3a‘). L’accumulation significativement plus élevée de nucléoprotéine (NP) dans les cellules en mousse par rapport aux macrophages infectés par l’isolat SARS-CoV-2 USA WA1/2020 (Fig. 2b et Extended Data Fig. 3b) a confirmé une susceptibilité plus élevée des cellules de mousse au virus. En fait, bien que la fréquence de NP+ les cellules de mousse ont diminué entre 24 heures après l’infection (hpi) et 48 hpi, la proportion de SARS-CoV-2 NP+ les cellules de mousse sont restées significativement plus élevées que celles du NP+ macrophages (Fig. 2b‘). Les cellules de mousse ont également accumulé plus d’ARNv S du SRAS-CoV-2 que les macrophages (Fig. 2c‘). le génome du vRNA du SRAS-CoV-2 était détectable dans les macrophages et les cellules de mousse dès 2 hpi, est resté élevé jusqu’à 24 hpi, mais a été réduit à 48 hpi dans les deux types de cellules (Fig. 2d et Extended Data Fig. 3d‘). Notamment, l’expression des gènes SARS-CoV-2 a diminué significativement plus rapidement dans les macrophages que dans les cellules en mousse, avec un vRNA significativement plus faible à 48 hpi (Fig. 2e). Cette décroissance temporelle dynamique des niveaux d’ARNV indique que les macrophages sont capables de nettoyer le virus plus rapidement que les cellules en mousse. Quoi qu’il en soit, bien qu’il soit sensible, les macrophages et les cellules en mousse n’ont pas soutenu une formation productive de particules virales infectieuses comme en témoignent les résultats du test de plaque à l’aide de cellules Vero E6 modifiées exprimant la transmembrane protéase sérine 2 et enzyme humaine de conversion de l’angiotensine 2 ( Vero E6-TMPRSS2-T2A-ACE2 ). Ces tests ont montré un déclin progressif des milieux conditionnés par le titre viral des macrophages infectés et des cellules en mousse ( Fig. 2f et Fig. Donnée étendue. 3c). Ces résultats sont cohérents avec l’infection abortive, un résultat courant de nombreuses infections virales, les cellules infectées ne produisant pas de virus compétent en réplication malgré la production d’ARNV22,23,24,25,26.

Fig. 2: Réponse différentielle du FCI et dynamique de clairance virale dans les macrophages humains et les cellules en mousse après une infection in vitro au SRAS-CoV-2.
figure 2

un, Quantification des macrophages et cellules en mousse à reporter mNG (n = 21 images par condition ). b, Quantification des macrophages infectés par le SRAS-CoV-2 ( 24 hpi, n = 20; 48 hpi, n = 24 ) et cellules en mousse ( 24 hpi, n = 20; 48 hpi, n = 18 ). Images représentatives pour un et b afficher les résultats à 48 hpi. Barres d’échelle, 20 μm. L’ANOVA à sens unique avec le test post- hoc de Tukey a été réalisée. Les données sont présentées sous forme de valeurs moyennes ± s.e.m. c, Quantification ARN-FISH de l’ARNv SRAS-CoV-2+ copies cellulaires et fréquence en macrophages (n = 37 ) et cellules en mousse (n = 26). Les données sont présentées sous forme de valeurs moyennes ± s.e.m. Barres d’échelle, 20 um. Mann–Whitney U-test a été effectué. d, Carte thermique des gènes viraux SARS-CoV-2 lit dans les macrophages et les cellules de mousse. e, Carte de chaleur de journal2FC de gènes viraux SARS-CoV-2 dans les macrophages versus cellules en mousse. Le test Wald du paquet DESeq2 a été utilisé pour tester l’importance. Ajusté P les valeurs < 0,05 (FDR = 1%) ont été considérées comme significatives. f, Quantification du titre viral des macrophages infectés par le SRAS-CoV-2 et des surnageants de culture de cellules en mousse (n = 6). Les données sont présentées sous forme de valeurs moyennes ± s.e.m. ANOVA à sens unique suivie par Tukey’s post hoc test a été effectué. g, Diagramme de Venn des DEG dans les macrophages infectés versus non infectés, les cellules en mousse et les gènes partagés. Le test Wald du package DESeq2 a été utilisé pour tester la signification. Les tracés de barres présentent des voies de signalisation régulées classées par leur score combiné. *P < 0,05; **P < 0,01; ***P < 0,001. h, Cartes thermiques du journal2FC des gènes de réponse IFN dans les macrophages et les cellules en mousse. Le test Wald du package DESeq2 a été utilisé pour tester la signification. Réglé P les valeurs < 0,05 ( FDR = 10% ) ont été considérées comme importantes. L’astérisque entre parenthèses indique la comparaison de l’interaction entre l’infection et les termes temporels du modèle. *P < 0,05; **P < 0,01; ***P < 0,001. je, Carte de chaleur de journal2FC de macrophages infectés par le SRAS-CoV-2 versus mousse (n = 3 répétitions biologiques). Le test Wald du paquet DESeq2 a été utilisé pour tester l’importance. Ajusté P les valeurs < 0,05 (FDR = 10%) ont été considérées comme significatives. j, Tracés cinétiques longitudinaux de la réponse combinée de l’IFN et des scores des gènes SARS-CoV-2. Les données sont présentées comme log médian et 25e quartile–75e2FC des cellules infectées par le SRAS-CoV-2 par rapport aux cellules non infectées. Les tests d’hypothèses ont été effectués à l’aide du test de Wilcoxon.

Le SRAS-CoV-2 déclenche des réponses inflammatoires pro-athérogènes

D’après l’observation selon laquelle la réplication du SRAS-CoV-2 a été avortée dans les macrophages et les cellules en mousse et la preuve que la réponse inflammatoire hyperréactive au SRAS-CoV-2 est orchestrée par des macrophages dans d’autres tissus9,14,27, nous avons étudié la réponse immunitaire des macrophages et des cellules en mousse au SRAS-CoV-2. Analyse différentielle de l’expression des gènes des données ARN-seq des macrophages infectés et des cellules en mousse identifiées signatures transcriptionnelles partagées et uniques ( Fig. 2g). Comme prévu, les 1 254 gènes partagés comprenaient les gènes viraux du SRAS-CoV-2. D’autres gènes couramment régulés étaient impliqués dans les réponses antivirales et l’infection au SRAS-CoV-2, y compris les voies de signalisation de l’interféron ( IFN ) et les processus antiviraux par signalisation IFN de type I et II, oligoadénylate synthétase ( OEA ) réponse antivirale, régulation négative de la réplication virale et du cycle de vie viral ainsi que l’activation du complément et la signalisation des cytokines. La signalisation antivirale ISG15, qui amortit la signalisation IFN et a été impliquée dans la réponse hyperinflammatoire associée à la gravité COVID-1927,28, a également été régulé à la hausse dans les deux types de cellules ( Fig. 2g et Fig. Donnée étendue. 3e). Les macrophages infectés ont exprimé une signature transcriptionnelle unique associée à l’activation classique de la cascade du complément, complément la cascade ( Fig. 2g et Fig. Donnée étendue. 3f) ainsi que la signalisation IFN-γ et sa régulation et la signalisation IL-27, qui induisent des gènes dépendants IFN / STAT129 et régulation des voies cytokines ( Fig. 2g). Nous avons également observé une régulation ascendante significative de certains gènes lysosomaux dans les macrophages infectés par rapport aux cellules mousseuses à 2 hpi et 8 hpi ( Données étendues Fig. 3g, h), révélant une réponse lysosomale plus robuste dans les macrophages qui peut contribuer à la clairance virale plus efficace observée dans les macrophages. Notre analyse a montré une augmentation significative des gènes codant pour les protéines impliquées dans l’absorption des lipides dans les macrophages infectés par rapport aux cellules de mousse (Fig. 2g et Extended Data Fig. 3i‘). Ceux-ci inclus CD36, codant pour le récepteur CD36 pour oxLDL, ainsi que LDLR, codant pour le récepteur LDL, qui est la lipoprotéine primaire porteuse de cholestérol dans le plasma et facilite l’absorption des LDL dans les cellules par endocytose. En revanche, les gènes codant des protéines associées à l’efflux lipidique (c’est-à-dire, ABCG1 et ABCA1) ont été significativement régulés à la baisse dans les macrophages infectés par rapport aux cellules de mousse (Données étendues Fig. 3i‘). Les lipides et les gouttelettes lipidiques jouent un rôle crucial dans le cycle de vie viral, y compris le SRAS-CoV-2 (refs. 30,31,32‘). En favorisant l’absorption et l’accumulation des lipides dans les macrophages, le SRAS-CoV-2 peut créer un environnement cellulaire favorable à l’infection virale.

La signature transcriptionnelle unique des cellules en mousse infectée comprenait 570 gènes ( Fig. 2g et Fig. Donnée étendue. 2e). Les voies de signalisation à régulation ascendante supérieure impliquaient la régulation négative du complexe d’histocompatibilité majeur classe I ( MHC-I ), une réponse induite par de nombreux virus pour échapper à la reconnaissance immunitaire33,34. Les cellules en mousse infectées ont également bouleversé les processus et les voies de signalisation impliqués dans la régulation du métabolisme lipidique qui peuvent faciliter l’entrée et la réplication virales32.

L’activation d’une réponse IFN de type I dans les macrophages et les cellules en mousse infectés par le SRAS-CoV-2 était cohérente avec la régulation excessive de plusieurs gènes, avec la réponse la plus forte observée à 8 hpi ( Fig. 2h et Fig. Donnée étendue. 3e). Dans les macrophages, les gènes significativement régulés inclus IRF1, un activateur transcriptionnel de l’IFN-α et de l’IFN-β, ainsi que des gènes induits par l’IFN-α, l’IFN-β et l’IFN-γ; MX1, codant pour une protéine Mx1 liant le GTP qui a une activité antivirale contre les virus à ARN, y compris les références SRAS-CoV-2 (. 35,36); ainsi que STAT1 et STAT2. IRF7, connu pour induire des réponses IFN de type I, et le facteur de restriction virale IFITM1 ( ref. 37), ont également été régulés à la hausse dans les macrophages infectés par le SRAS-CoV-2 ( Fig. 2h). La réponse de l’IFN dans les cellules en mousse infectées par le SRAS-CoV-2 était similaire, bien qu’il y ait eu une déréglementation retardée MX1 qui ne s’est produit qu’à 48 hpi, ce qui correspond à l’accumulation plus élevée d’ARNV et de protéines observée dans les cellules en mousse, et uniquement les cellules en mousse régulées à la hausse IRF4, qui inhibe la signalisation MyD88 et est exprimé en macrophages de type M238. De plus, l’expression de STAT1 et STAT2 n’ont pas été significativement augmentés ( Fig. 2h), suggérant une régulation distincte de la signalisation JAK/STAT induite par l’IFN dans les macrophages infectés. Une comparaison directe entre les macrophages infectés et les cellules de mousse infectées a confirmé une réponse IFN plus forte dans les macrophages par rapport aux cellules de mousse avec une régulation positive significative de JAK1 à 2 hpi et de MAV, codant la protéine de signalisation antivirale mitochondriale essentielle à l’immunité innée antivirale39,40,41, 8 Hpi (Fig. 2i‘).

L’analyse des changements dynamiques de la réponse IFN-I entre les macrophages et les cellules de mousse en utilisant une méthode de notation de signature de gène IFN et SARS-CoV-2 (Méthodes) ont révélé des différences cinétiques importantes dans la réponse à l’IFN et l’expression du gène SARS-CoV-2 entre les macrophages et les cellules de mousse (Fig. 2j). Bien qu’il n’y ait pas de différence significative dans le score du génome du SRAS-CoV-2 entre les macrophages infectés et les cellules en mousse, à 48 hpi, une réduction significative du score du génome du SRAS-CoV-2 a été observée dans les macrophages mais pas dans les cellules en mousse, indiquant une stabilité différentielle de l’ARNV. En parallèle, le score IFN-I a augmenté à la fois dans les macrophages infectés et les cellules en mousse, mais les cellules en mousse ont affiché une baisse significative du score IFN-I à 24 hpi et 48 hpi. Compte tenu des connaissances bien établies que l’IFN de type I réduit l’infection et la réplication du SRAS-CoV-2, favorisant ainsi la clairance virale42,43,44,45, la réponse IFN robuste et soutenue de type I dans les macrophages contribue probablement à une diminution de la persistance virale. De plus, les macrophages et les cellules en mousse ne présentaient pas de différences dans l’activation des voies apoptotiques, telles que la sécrétion de Caspase-8 ( Données étendues Fig. 3j). Plusieurs gènes pro-inflammatoires et pro-athérogènes de cytokine et de chimiokine ont été significativement régulés à la fois dans les macrophages infectés et les cellules en mousse ( Données étendues Fig. 4a, b). Ceux inclus CCL7TNFSF10 ( également connu sous le nom de TRAIL), CXCL10 et CCL3. Macrophages infectés uniquement régulés CXCL9CXCL12 et CLEC11A, alors que les cellules de mousse ont été régulées à la hausse TNFACCL5 et CCL2.

Pour approfondir le profil inflammatoire des macrophages et des cellules en mousse en réponse à l’infection par le SRAS-CoV-2, nous avons quantifié la sécrétion de cytokines et de chimiokines jusqu’à 48 hpi ( Fig. 3 et Fig. Donnée étendue. 4b). Plusieurs cytokines pro-inflammatoires et pro-athérogènes ( par exemple, IL-6, CCL7, IL-1β, β-NGF, IL-3, LIF, MIF, CXCL9, IFN-α et IFN-γ ) ont été libérés par les macrophages infectés et les cellules en mousse ( Fig. 3a). Parmi ceux-ci figurent des cytokines clés connues pour déclencher des événements cardiovasculaires ischémiques, y compris l’IL-6, une cible thérapeutique candidate dans les essais cliniques en cours46, et IL-1β, dont l’inhibition a réduit les événements cardiovasculaires secondaires chez les patients à risque post-infarctus du myocarde élevé47 ( Fig. 3b‘). De plus, la libération du facteur inhibiteur de la migration des macrophages (MIF), une cytokine pro-athérogène et inflammatoire qui a été impliquée dans l’épaississement intima-média, le dépôt lipidique et l’instabilité de la plaque48, a été augmenté dans les deux types de cellules après infection. Cette analyse a également révélé des profils d’expression différentielle des cytokines sécrétées par les macrophages et les cellules de mousse en réponse à l’infection par le SRAS-CoV-2, suggérant des réponses inflammatoires distinctes entre les macrophages et les cellules de mousse. Par example, la cytokine pro-athérogène IL-18 (ref. 49) a été significativement libéré par les macrophages infectés mais pas les cellules de mousse, alors que IFN-2, une cytokine de réponse IFN de type I qui inhibe la réplication virale50, a été significativement libéré par les cellules en mousse infectées mais pas par les macrophages ( Fig. Données étendues. 4b). Nous avons notamment détecté des différences significatives de libération de bon nombre de ces cytokines au fil du temps entre les cellules macrophages et mousse non infectées, suggérant que les différences dans l’état inflammatoire de base de chaque type de cellule influencent leurs réponses au virus ( Fig. 3b et Fig. Donnée étendue. 4b).

Fig. 3: Analyse de la dynamique de libération de cytokines après une infection au SRAS-CoV-2.
figure 3

un, Carte thermique des cytokines et des chimiokines sécrétées des macrophages et des cellules en mousse infectés par le SRAS-CoV-2. Les données sont affichées sous forme de journal2FC de cellules infectées versus non infectées. P les valeurs ont été calculées par un test t non apparié à deux queues, *P < 0,05; **P < 0,01; ***P < 0,001. Réglé P les valeurs ( Benjamini – La méthode Hochberg ) sont présentées entre parenthèses. b, Les parcelles cinétiques montrent l’ASC des cytokines sécrétées par les macrophages et cellules en mousse infectés par le SRAS-CoV-2 par rapport aux cellules non infectées (n = 4 répétitions biologiques, doublons techniques ). Pour les comparaisons AUC, l’ANOVA unidirectionnelle après le test de comparaisons multiples de Tukey a été effectuée. Les différences cinétiques ont été évaluées par l’ANOVA bidirectionnelle suivie du test de comparaisons multiples de Sidak. Les données sont présentées comme moyennes ± s.e.m. Les placettes de bar montrent la quantification de l’ASC pour chaque cytokine. Analyse statistique ANOVA unidirectionnelle après le test de comparaisons multiples de Tukey.

Le SRAS-CoV-2 stimule l’inflammation des explants vasculaires athérosclérotiques

Déterminer si la réponse pro-inflammatoire des cellules macrophages et moussants au SRAS-CoV-2 que nous avons observée in vitro se produit également dans les tissus vasculaires humains, nous avons infecté des explants vasculaires athérosclérotiques humains avec l’isolat SRAS-CoV-2 USA WA1 // 2020 ( Fig. 4a). ARNv SRAS-CoV-2 codant pour la pointe des protéines structurelles ( S ), enveloppe ( E ), membrane ( M ) et nucléocapside ( N ), ainsi que des cadres de lecture ouverts ( ORF ) codant pour les protéines accessoires non structurelles, ont été détectables dans les plaques infectées dès 24 hpi et jusqu’à 72 hpi ( Fig. 4b). L’expression des protéines S et N et les particules de type virus ont été observées dans des plaques athérosclérotiques infectées ( Fig. Données étendues. 5a, b). Cependant, le titre viral a diminué au fil du temps sans virus infectieux isolé des milieux conditionnés des cellules ou des tissus infectés à l’aide d’un test de plaque jusqu’à 72 hpi, suggérant une réplication avortée dans les explants vasculaires ( Fig. 4c). Quoi qu’il en soit, l’infection au SRAS-CoV-2 a induit une forte réponse transcriptionnelle IFN de type I dans les plaques infectées reflétée par la régulation précoce des facteurs de transcription et des gènes impliqués dans la réponse aux infections virales, telles que IRF7JAK1 et IFITM1 à 2 hpi; IFNARIRF4IRF1MX1PTPN6IFNA1STAT1 et STAT2 à 24 hpi; IRF1IFNA7 et IFI35 à 48 hpi; et IFNA16 à 72 hpi. Généralités impliquées dans la régulation négative de la signalisation IFN ( c’est-à-dire, SOCS1 et SOCS3) a également été régulé à la hausse, reflétant probablement l’activation de la signalisation réglementaire ( Fig. 4d). Fait intéressant, l’infection au SRAS-CoV-2 a déclenché l’expression de récepteurs viraux et de facteurs d’entrée, tels que ACE2PNR1FURINTMPRSS4TMPRSS11A et CTSB à 24 hpi, ce qui suggère que le virus facilite sa propre entrée dans les cellules hôtes ( Fig. 4e). Le SRAS-CoV-2 a également lancé une réponse pro-inflammatoire transcriptionnelle qui a largement récapitulé celle observée dans les macrophages et les cellules en mousse cultivés. Cela comprenait la régulation des cytokines pro-athérogènes, comme IL1BIL6MIFILBTNFIL7 et CCL5, ainsi que des chimiokines, telles que CCL2CCL3CCL4CCL5CXCL9CCL27CCL7CCL6CXCL1CXCL8CXCL9 et CXCL12. Cytokines anti-inflammatoires, telles que IL10 et IL13, ont été déréglementés, soutenant davantage une forte réponse inflammatoire pro-athérogène à l’infection par le SRAS-CoV-2 dans les plaques athérosclérotiques humaines ( Fig. 4f et Fig. Donnée étendue. 5c). L’analyse du sécrétome des plaques infectées a révélé des changements similaires de protéines pro-inflammatoires ( Fig. 4g). Les plaques infectées par le SRAS-CoV-2 ont libéré plusieurs cytokines et chimiokines pro-athérogènes, dont IL-6, IL-1β et IFN-α2, ainsi que CCL2, CCL3, CCL4 et CCL7 ( Fig. 4g‘). La libération de cytokines et de chimiokines était sensiblement plus élevée à 72 hpi. Cependant, seuls l’IL-6, l’IL-1, l’IFN-levante2 et le CCL3 ont été sécrétés à des quantités significativement plus élevées au fil du temps calculées comme surface sous la courbe (ASC) (Fig. 4h et Extended Data Fig. 5d‘). Une réponse inflammatoire plus forte a été observée dans les plaques athérosclérotiques infectées par le SRAS-CoV-2 par rapport aux marges chirurgicales appariées non athérosclérotiques, comme le montre la libération significativement plus élevée de plusieurs cytokines (par exemple, IFN-similaire, IFN-2, IL-1, IL-17, TNF-17, TNF-F, CCL3, CCL4 et CCL7) à partir de plaques infectées principalement à 48 hpi (Fig. 4i). Ces résultats suggèrent que l’infection au SRAS-CoV-2 déclenche une réponse immunitaire hyperactivée principalement dans les lésions athérosclérotiques, une réponse qui pourrait contribuer au risque accru d’événements cardiovasculaires ischémiques chez les patients atteints de COVID-19 atteints d’athérosclérose sous-jacente.

Fig. 4: Réponse immunitaire de l’hôte à l’infection par le SRAS-CoV-2 des explants vasculaires de l’athérosclérose humaine.
figure 4

a, Schémas de l’approche expérimentale de l’infection d’explants vasculaires carotides humains avec le SRAS-CoV-2. b, 2, Carte thermique des lectures virales du SRAS-CoV-2 dans les explants vasculaires carotides à l’inclusion (0 hpi), 24 hpi, 48 hpi et 72 hpi. c, Quantification du titre viral infectieux des surnageants de culture de plaque carotidienne infectés par le SRAS-CoV-2 (n = 3 échantillons biologiques, duplicatas techniques). Les données sont présentées sous forme de valeurs moyennes ± s.e.m. ANOVA à sens unique suivie par Tukey’s post hoc test a été effectué. d, Carte de chaleur montrant le standardisé zexpression marquée des gènes de réponse à l’IFN dans des échantillons vasculaires carotides infectés par le SRAS-CoV-2 à différents moments après l’infection. e, Carte de chaleur de standardisé z-expression marquée de récepteurs viraux hôtes sélectionnés et de facteurs d’entrée dans des échantillons vasculaires carotides humains infectés par le SRAS-CoV-2. f, Carte thermique de normalisé z-expression génique marquée des gènes de cytokine et de chimiokine dans les explants vasculaires carotides humains infectés par le SRAS-CoV-2 à différents moments après l’infection. g, Carte thermique des cytokines et des chimiokines sécrétées à partir de plaques athérosclérotiques humaines infectées par le SRAS-CoV-2. Les données sont affichées sous forme de journal2FC d’échantillons infectés versus non infectés. P les valeurs ont été calculées par des paires à deux queues t-test, *P < 0,05; **P < 0,01; ***P < 0,001. P les valeurs entre parenthèses ont été ajustées à l’aide de la méthode Benjamini – Hochberg. h, Les parcelles cinétiques montrent l’ASC des cytokines et des chimiokines sécrétées par des plaques carotides non infectées ou infectées par le SRAS-CoV-2 (n = 3 donneurs, doublons techniques ). Les données sont présentées sous forme de valeurs moyennes ± s.e.m. Analyse statistique ANOVA bidirectionnelle après le test de comparaisons multiples de Sidak. En couple t-test a été effectué pour comparer l’ASC de deux groupes. je, Tracé montrant l’expression relative de cytokines sécrétées et de chimiokines entre la plaque athérosclérotique infectée par le SRAS-CoV-2 par rapport aux marges vasculaires. L’expression relative est représentée dans le journal2Échelle colorée FC. La signification statistique est exprimée en taille de point. Les valeurs statistiquement significatives sont représentées en cercles et les changements non significatifs sont représentés en diamants. P les valeurs ont été calculées par un apparié à deux queues t-test. P les valeurs ont été ajustées à l’aide de la méthode Benjamini – Hochberg.

PNR1+ les macrophages augmentent la sensibilité de la plaque au SRAS-CoV-2

Pour élucider la susceptibilité vasculaire à l’infection par le SRAS-CoV-2, nous avons évalué l’expression des principaux récepteurs d’entrée virale et des cofacteurs dans l’aorte, artères coronaires et tibiales à l’aide de données d’expression génique accessibles au public dans le cadre du projet Genotype-Tissue Expression (GTEx) (https://gtexportal.org/home/‘). Le poumon, le tissu cardiaque et le sang total ont également été inclus dans cette analyse (Données étendues Fig. 6a, b‘). Nous nous sommes concentrés spécifiquement sur ACE2, encodant le premier récepteur rapporté pour l’entrée du SRAS-CoV-2 dans les cellules humaines; neuropilines (PNR1 et PNR2); et les protéases TMPRSS2FURINE, cathepsine B (CTSB) et cathepsine L (CTSL), nécessaire pour cliver la protéine S pour l’entrée et la réplication virales51,52,53,54. L’analyse du séquençage de l’ARN en vrac ( RNA-seq ) a montré un modèle d’expression similaire pour ACE2PNR1PNR2FURIN et CTSB et CTSL dans l’aorte, les artères coronaires et tibiales par rapport au poumon, à l’exception de TMPRSS2, qui a été exprimé à des niveaux inférieurs dans les artères ( Données étendues Fig. 6b).

Étudier l’expression cellulaire du récepteur du SRAS-CoV-2 et les facteurs d’entrée dans le tissu athérosclérotique humain, nous avons effectué une analyse scRNA-seq intégrée des plaques de carotide humaine de 10 patients subissant une endartériectomie carotidienne (AEC) et des données coronariennes athérosclérotiques obtenues à partir de sept échantillons coronaires de quatre cas de transplantation cardiaque accessibles au public dans le GEO (GSE131780) (Fig. 5a‘)15. Les deux ensembles de données ont été fusionnés en utilisant l’algorithme Harmony, résultant en 16 sous-groupes de cellules immunitaires qui correspondaient à toutes les populations immunitaires majeures infiltrant les plaques athérosclérotiques humaines (Données étendues Fig. 6c‘). Les récepteurs d’entrée du SRAS-CoV-2 et les facteurs d’entrée de l’hôte tels que PNR1, 2, un récepteur du SRAS-CoV-2 qui peut lier la protéine S clivée par FURIN pour faciliter l’entrée virale du SRAS-CoV-2, et les protéases CTSB et CTSL étaient fortement exprimés dans les sous-groupes myéloïdes, alors que ACE2 et les protéases à sérine transmembranaires TMPRSS2, TMPRSS4, TMPRSS11A et TMPRSS11B étaient soit indétectables, soit exprimés à de faibles niveaux (Données étendues Fig. 6d‘). Sur la base de cette observation, nous avons sous-clusté les cellules myéloïdes (Fig. 5b et Extended Data Fig. 6e) et identifié deux groupes de cellules dendritiques ( DC ), trois groupes de monocytes / macrophages, un groupe de cellules myéloïdes mixtes et quatre groupes de macrophages/cellules en mousse annotées sur la base de l’expression de marqueurs canoniques ( Données étendues Fig. 6f). Pour identifier les différences significatives dans l’abondance des cellules myéloïdes entre les artères carotides et coronaires, nous avons effectué des tests d’abondance du quartier différentiel de Milo55. Cette analyse a révélé que TREM2+ les macrophages ont été enrichis en tissu coronaire, tandis que VCAN+ monocytes / macrophages et CD1c+ Les CC ont été enrichis en échantillons de carotides. CD16+ monocytes, monocytes / macrophages inflammatoires, IL1B+ DC et CD36+ les cellules myéloïdes mixtes étaient exclusivement présentes dans les échantillons de carotides, alors que LYVE1+ des macrophages étaient présents dans les coronaires. SPP1+ des macrophages étaient présents dans les deux tissus ( Fig. 5c). Dans l’ensemble, PNR1 a été fortement exprimé en TREM2+SPP1+LYVE1+ et gène stimulé par l’IFN (ISG)+TREM2 + macrophages, grappes qui ont également exprimé FURIN. ACE2 et TMPRSS2 étaient indétectables dans les cellules myéloïdes analysées (Fig. 5d‘). PNR1 et FURINE l’expression génique était plus élevée dans les plaques athérosclérotiques humaines que dans les marges normales appariées (Fig. 5e), suggérant un rôle clé pour le PNR-1 dans la médiation de l’infection par le SRAS-CoV-2 du système vasculaire athérosclérotique. L’analyse spatiale RNA-FISH de spécimens d’autopsie coronarienne humaine de patients atteints de COVID-19 a confirmé que les macrophages s’expriment PNR1 (CD68+PNR1+ les cellules) ont infiltré les lésions coronaires et que ces cellules ont également exprimé le vRNA S du SRAS-CoV-2 et le brin antisens du gène S, indiquant une réplication virale (Fig. 5f, g‘). Un nombre plus élevé de PNR1+ des macrophages exprimant le brin antisens du gène S ont été trouvés dans les lésions coronaires PIT, ce qui correspond à la plus grande susceptibilité des lésions PIT à l’infection (Fig. 5g‘).

Fig. 5: Expression unicellulaire du récepteur du SRAS-CoV-2 et facteurs d’entrée dans le tissu athérosclérotique humain.
figure 5

a, scRNA-seq de la carotide humaine (n = 10) et coronaire (GSE131780() (n = 7) échantillons de tissus. b, visualisation UMAP des sous-groupes de cellules myéloïdes à partir d’échantillons coronariens (1 960 cellules) et carotidiens (2 900 cellules). Le diagramme à barres montre la fréquence de chaque groupe myéloïde. c, Graphique de voisinage des résultats du test d’abondance différentielle MiloR. Les nœuds représentent les quartiers, colorés par leur journal2FC entre les échantillons de carotide (rouge) et coronaire (bleu). Les quartiers d’abondance non différentiels sont en blanc (FDR = 10%), et la taille des nœuds reflète le nombre total de cellules dans chaque quartier. Les parcelles de Beeswarm montrent le journal2distribution FC des voisinages entre le type de tissu (FDR = 10%). d, Dot plot de l’expression du gène moyen du facteur d’entrée viral SARS-CoV-2 et pourcentage d’expression dans chaque sous-groupe myéloïde. e, des parcelles ponctuelles montrant la fréquence des cellules exprimant les facteurs d’entrée virale du SRAS-CoV-2 colorés par l’expression moyenne dans les lésions de la plaque athéroscléreuse et les marges de vascularisation appariées. f, Images représentatives de H&E et analyse spatiale de l’échantillon coronaire PIT montrant l’emplacement de CD68+PNR1+ cellules, CD68+PNR1+ SARS-CoV-2 S+ ou S antisens+ cellules. g, Parcelles de barres montrant le total PNR1+ ARNv du SRAS-CoV-2+ et CD68+PNR1+ ARNv du SRAS-CoV-2+ cellules normalisées par zone tissulaire (mm2) dans AIT (n = 3), FOSSE (n = 6), fibrocalciques (n = 8) et fibroathérome (n = 3) coronaires. h, Images représentatives et quantification RNA-FISH de la fréquence de PNR1+ cellules et moyenne PNR1 copies par cellule dans les macrophages non infectés (n = 27) et cellules de mousse (n = 28). Barres d’échelle, 20 um. L’analyse statistique a été réalisée en utilisant des Student’s non appariés à deux queues t-test. Avg, moyenne; Mac, macrophages; Mon, monocytes.

Compte tenu de cela PNR1 a été fortement exprimé en TREM2+ macrophages, qui sont considérés comme des macrophages de plaque mousseux56, et il était significativement plus élevé dans les cellules de mousse par rapport aux macrophages in vitro (Fig. 5h), nous avons effectué des expériences supplémentaires en utilisant l’ARN silencieux (siRNA) pour inhiber spécifiquement l’expression de NRP-1 et étudier son impact sur l’infection par le SRAS-CoV-2 (Fig. 6a, b et Extended Data Fig. 7a–f‘). Nous avons réalisé la réduction efficace (~80%) de PNR1 expression génique dans les macrophages et les cellules de mousse, confirmée par western blotting et analyse de l’ARNscope (Données étendues Fig. 7a–d et Complémentaire Fig. 2‘). Sur PNR1 en réduisant au silence les cellules infectées, nous avons observé une diminution significative de la fréquence de l’antisens S du SRAS-CoV-2+ macrophages et cellules de mousse ainsi qu’une fréquence réduite de SARS-CoV-2 S+ cellules de mousse (Fig. 6a et Extended Data Fig. 7e‘). Ces résultats ont été confirmés en utilisant EG00229, une petite molécule qui empêche la liaison du SRAS-CoV-2 au domaine B1 du PNR-1 et réduit l’infection des lignées cellulaires par le SRAS-CoV-253,54 (Fig. 6b et Extended Data Fig. 7f‘).

Fig. 6: Abrogation de l’infection par le SRAS-CoV-2 médiée par le PNR-1.
figure 6

un, Images représentatives de la quantification ARN-FISH basée sur l’IA montrant PNR1 ARN, SRAS-CoV-2 S et S antisens+ cellules. Barres d’échelle, 50 μm. Quantification de la fréquence du SRAS-CoV-2 S+ et SRAS-CoV-2 S antisense+ cellules en macrophages et cellules en mousse traitées avec un contrôle de l’ARNsi non ciblant ou siRNA NRP1 à 24 hpi. Les données sont présentées sous forme de valeurs moyennes ± s.e.m. Une analyse statistique a été réalisée à l’aide d’un étudiant à deux queues non jumelé t-test. b, Images représentatives de la quantification ARN-FISH montrant PNR1 ARN, SRAS-CoV-2 S et S antisens+ cellules. Barres d’échelle, 20 μm. Quantification de la fréquence du SRAS-CoV-2 S+ et antisens SARS-CoV-2 S+ cellules dans les macrophages et les cellules de mousse avec et sans inhibition de NRP1 (EG00229 trifluoroacétate) à 24 hpi. c, Carte thermique des niveaux de cytokines et de chimiokines sécrétées de manière différentielle à partir de macrophages infectés par le SRAS-CoV-2 et de cellules de mousse (n = 4–5) après traitement avec contrôle siRNA ou siRNA NRP1 à 24 hpi. Ajusté P les valeurs < 0,05 ont été considérées comme significatives. Asterisk indique un ajustement P valeur < 0,05 pour la comparaison du SRAS-CoV-2 infecté et traité avec le siRNA NRP1 contre le contrôle infecté et le siRNA. Les astérisques entre parenthèses indiquent une valeur nominale P < 0,05 pour la comparaison entre les macrophages et les cellules en mousse, *P < 0,05; <TAG1>; **P < 0,01; <TAG1>; ***P < 0,001. d, Carte thermique des niveaux de cytokines et de chimiokines sécrétées de manière différentielle à partir de macrophages infectés par le SRAS-CoV-2 et de cellules de mousse après blocage du PNR1 (EG00229 trifluoroacétate). Les résultats sont affichés sous forme de journal2FC entre les conditions infectées et non traitées. Ajusté P les valeurs < 0,05 ont été considérées comme significatives. Asterisk indique un ajustement P valeur < 0,05 pour la comparaison des conditions infectées et traitées par le SRAS-CoV-2 par rapport aux conditions infectées et traitées par le véhicule. Les astérisques entre parenthèses indiquent une valeur nominale P valeur < 0,05 pour la comparaison entre macrophages et cellules en mousse, *P < 0,05; <TAG1>; **P < 0,01; <TAG1>; ***P < 0,001. e, Tracé montrant l’expression relative de cytokines et de chimiokines sécrétées provenant du blocage du PNR1 ( EG00229 trifluoroacétate ) traités versus plaques athérosclérotiques infectées par le SRAS-CoV-2 non traitées à 48 hpi. L’expression relative est représentée dans le journal2Échelle colorée FC. Les cercles représentent des résultats statistiquement significatifs et les changements non significatifs sont représentés comme des diamants.

Nous avons ensuite demandé si PNR1 le silence ou le blocage à l’aide d’EG00229, qui réduisait l’infection des macrophages et des cellules en mousse in vitro, réduirait la réponse inflammatoire au SRAS-CoV-2. Les résultats ont révélé que le silencieux NRP1 augmentait l’état inflammatoire de base des macrophages non infectés et, dans une moindre mesure, des cellules en mousse, comme en témoigne la libération de plusieurs cytokines et chimiokines ( Données étendues Fig. 8a). Notamment, cet état inflammatoire a persisté sous l’infection par le SRAS-CoV-2, infecté PNR1-les cellules silencieuses présentant des niveaux plus élevés de cytokines induites par le virus, telles que l’IL-6 et le MIF, par rapport aux cellules non infectées du PNR1 ( Fig. 6c et Fig. Donnée étendue. 8a). Dans les cellules en mousse, le silencieux NRP-1 a eu des effets plus modestes sur les cellules non infectées et infectées, la libération de cytokines inflammatoires étant principalement due à l’infection par le SRAS-CoV-2 ( Fig. 6 et Fig. Donnée étendue. 8a). Les résultats sont cohérents avec les fonctions anti-inflammatoires du PNR-1 dans les cellules myéloïdes et l’augmentation de l’inflammation lorsque l’expression du PNR1 est perdue57,58. Fait intéressant, l’utilisation d’EG00229 a donné des schémas inflammatoires similaires, mais certaines différences peuvent suggérer des effets hors cible potentiels associés à cet inhibiteur ( Fig. 6d). Étudier la modulation potentielle du TGF-β par PNR1 l’inhibition, nous avons examiné la sécrétion de TGF-E dans les macrophages infectés et les cellules de mousse (Extended Data Fig. 8b‘). Bien que, dans les macrophages, l’expression de TGF-sondage n’ait pas été affectée par l’infection par le SRAS-CoV-2, et l’inhibition de NRP-1 n’a pas influencé son expression, nous avons observé une augmentation des niveaux de TGF-stimulant dans les cellules de mousse infectées en raison de l’infection par le SRAS-CoV-2 qui a été partiellement réduite par l’inhibition du PNR-1. Le blocage du PNR-1 a augmenté la libération d’IL-6 et de CCL2 sécrétées par le tissu d’explant vasculaire athérosclérotique humain infecté par le SRAS-CoV-2. La libération d’IL-1 et d’IL-18 a également été augmentée mais pas de manière significative (Fig. 6e). Ensemble, ces résultats suggèrent que les plaques athérosclérotiques sont particulièrement sensibles à l’infection par le SRAS-CoV-2, qui déclenche une réponse immunitaire hyperactivée qui pourrait contribuer au risque accru d’événements cardiovasculaires ischémiques chez les patients atteints de COVID-19 avec athérosclérose sous-jacente. Bien que l’inhibition du facteur d’entrée de l’hôte NRP-1 exprimée par des macrophages infiltrant des lésions coronariennes chez l’homme ait réduit l’infection au SRAS-CoV-2, elle a également induit une forte réponse inflammatoire, indiquant que des stratégies alternatives seront nécessaires pour prévenir l’infection par le SRAS-CoV-2 des vaisseaux coronariens et ses conséquences en aval.

Discussion

Bien que le SRAS-CoV-2 soit considéré comme un virus respiratoire, les patients atteints de COVID-19 se sont révélés présenter un risque accru de complications cardiovasculaires, y compris un infarctus du myocarde et un accident vasculaire cérébral. Notre étude fournit des preuves de la présence du SRAS-CoV-2 dans le système vasculaire coronarien humain et démontre un tropisme viral pour les macrophages des lésions vasculaires chez les personnes atteintes de COVID-19 sévère. Nous avons trouvé des preuves de réplication du SRAS-CoV-2 dans tous les coronaires d’autopsie humaine analysés, quelle que soit leur classification pathologique, bien que la réplication virale ait été la plus élevée dans les lésions coronariennes PIT — les lésions précoces qui progressent vers des plaques athérosclérotiques plus avancées11,12. Il est bien établi que, à mesure que les lésions progressent vers des stades plus avancés, tels que les fibroathéromes et les plaques fibrocalciques, les macrophages et les cellules moussantes deviennent dysfonctionnels en raison d’une exposition prolongée aux lipides et d’un microenvironnement inflammatoire11,12. Dans les lésions PIT précoces, les macrophages qui tentent d’éliminer les lipides inflammatoires (par exemple, les oxLDL) accumulent un excès de cholestérol et de triglycérides dans les gouttelettes lipidiques cytoplasmiques12 peut être plus sujet aux infections virales. Le SRAS-CoV-2 a montré un tropisme plus fort pour les lésions artérielles que la graisse périvasculaire correspondante, qui était liée au degré d’infiltration des macrophages, compatible avec la réplication virale plus élevée dans les lésions PIT et les fibroathéromes, où les macrophages sont plus répandus. D’autres ont déjà signalé la présence d’ARNv du SRAS-CoV-2 dans le cœur et l’aorte ainsi que dans d’autres organes distants8,14,59,60. Nos données démontrent de manière concluante que le SRAS-CoV-2 est capable d’infecter et de reproduire dans les macrophages dans le vasculature coronaire des patients atteints de COVID-19. De plus, le SRAS-CoV-2 se reproduit préférentiellement dans les cellules en mousse par rapport à d’autres macrophages, en raison d’une réponse IFN réduite de type I qui conduit à l’ARNV et à l’accumulation de protéines virales, suggérant que ces cellules pourraient servir de réservoir de débris viraux du SRAS-CoV-2 dans la plaque athérosclérotique. Nos résultats démontrent que, bien que la réponse IFN de type I soit restée élevée dans les macrophages infectés par le SRAS-CoV-2, indiquant un état antiviral soutenu, les cellules en mousse infectées ne présentaient qu’une expression transitoire de l’expression du gène IFN de type I. Associé à l’expression réduite de gènes lysosomaux et à une réponse inflammatoire plus faible à l’infection par le SRAS-CoV-2,la réduction de l’IFN de type I peut contribuer à la persistance du SRAS-CoV-2 observée dans les spécimens d’autopsie athéroscléreuse analysés. Les macrophages résidant dans le tissu vasculaire peuvent subir l’auto-renouvellement, contribuant à leur entretien à long terme61, et, dans les études de transplantation cardiaque, il a été démontré que les macrophages cardiaques ont une demi-vie de 8,8 ans62. Par conséquent, il est possible que les macrophages agissent comme des réservoirs d’ARNv SRAS-CoV-2 dans des plaques athérosclérotiques. Nous avons également identifié des VSMC infectés dans des échantillons d’autopsie coronaire. Bien que le nombre de VSMC infectés soit inférieur à celui des macrophages infectés, les VSMC ont une demi-vie de 270 – 400 d63 et peut contribuer à la persistance du SRAS-CoV-2 dans la paroi artérielle.

L’infection à SRAS-CoV-2 des macrophages et des cellules en mousse a favorisé une forte réponse inflammatoire caractérisée par la libération de cytokines impliquées à la fois dans la pathogenèse de l’athérosclérose et le risque accru d’événements cardiovasculaires, tels que l’accident vasculaire cérébral et l’infarctus du myocarde46,47,64. En utilisant un modèle ex vivo d’infection virale d’explants vasculaires humains, nous avons constaté que le tissu athérosclérotique pouvait être directement infecté par le SRAS-CoV-2, confirmation de notre observation dans les tissus des patients atteints de COVID-19. Comme dans les macrophages cultivés et les cellules de mousse, l’infection par le SRAS-CoV-2 du tissu vasculaire a déclenché une réponse inflammatoire et induit la sécrétion de cytokines pro-athérogènes clés, telles que l’IL-6 et l’IL-1. Considérant que l’inflammation favorise la progression de la maladie et contribue à la rupture, nos résultats fournissent une base moléculaire sur la façon dont l’infection par le SRAS-CoV-2 des lésions coronariennes peut contribuer aux manifestations cardiovasculaires aiguës du COVID-19, telles que l’infarctus du myocarde3,5. L’infection par le SRAS-CoV-2 des coronaires n’était pas liée aux caractéristiques cliniques préexistantes, au stade de COVID-19 selon les jours de maladie, à la durée de l’hospitalisation au moment du décès ou aux comorbidités. Cependant, nous avons trouvé une accumulation plus élevée d’ARNv antisens S et S du SRAS-CoV-2 dans le système vasculaire coronaire des trois patients présentant des manifestations cardiovasculaires ischémiques aiguës, y compris un infarctus du myocarde postérieur (Pt. 1) et infarctus du myocarde de type II (Pt. 2 et Pt. 3). Bien qu’aucune preuve d’occlusion coronarienne n’ait été détectée à l’autopsie chez deux patients ayant reçu un diagnostic clinique d’infarctus du myocarde, ces données suggèrent que l’infection coronarienne SARS-CoV-2 pourrait augmenter le risque cardiovasculaire. Une analyse systématique de GTEx, un ensemble de données d’expression génique multi-tissus qui comprend des donneurs décédés d’une maladie cérébrovasculaire (>22% ) et les maladies cardiaques ( > 40% ), ont révélé un schéma d’expression similaire des récepteurs et cofacteurs du SRAS-CoV-2 dans le système vasculaire humain comme celui trouvé dans les poumons. En particulier, bien que ACE2 l’expression était faible dans l’aorte et l’artère tibiale, ses niveaux d’expression dans l’artère coronaire sont similaires à ceux du poumon, suggérant que le système vasculaire coronaire pourrait être plus sensible à l’infection virale par le SRAS-CoV-2 que les autres lits vasculaires. Au niveau unicellulaire, l’expression des récepteurs et des facteurs du SRAS-CoV-2 a confirmé nos résultats d’autopsie du système vasculaire coronarien. Bien que ACE2 l’expression n’était pas détectable par scRNA-seq, PNR1 et FURINE ils ont été fortement exprimés en deux TREM2+ les amas de macrophages, connus pour correspondre aux macrophages mousseux de la plaque56, ainsi que dans les groupes de SSP1+ macrophages et LYVE1+ macrophages. Nous avons également constaté que le SRAS-CoV-2 infecte le PNR1+ macrophages dans le tissu coronaire humain à l’autopsie et que la réplication virale était plus grande dans NRP1+ macrophages présents dans les lésions PIT. Expérimentalement, les deux font taire PNR1 gène et inhibiteur spécifique de l’interaction entre le domaine b1 de NRP-1 et le CendR SARS-CoV-2 S153,54 l’infectiosité réduite du SRAS-CoV-2 des macrophages primaires humains et des cellules en mousse, confirmant que l’infection par le SRAS-CoV-2 des cellules macrophages et en mousse dépend en partie du PNR-1. Cependant, une réponse aberrante pro-inflammatoire associée à l’inhibition du PNR-1 limite l’utilisation thérapeutique potentielle de l’inhibiteur du PNR-1. Cet effet pro-inflammatoire, bien qu’inattendu dans le contexte d’une infection au SRAS-CoV-2, est conforme aux constatations antérieures d’un rôle protecteur du PNR-1 dans la septicémie et de la libération accrue de cytokines pro-inflammatoires ( par exemple, IL-6 ) des macrophages nuls NRP-158.

Dans l’ensemble, nos données démontrent que le SRAS-CoV-2 se reproduit dans les macrophages au sein des coronaires humains des patients décédés d’un COVID-19 sévère. Notre étude se limite à l’analyse d’une petite cohorte de personnes âgées atteintes de COVID-19 et d’athérosclérose préexistante et d’autres conditions médicales et comorbidités. Par conséquent, nos observations ne peuvent pas être extrapolées à des individus plus jeunes et en bonne santé. Notre étude est également limitée aux cas survenus au cours des premières phases de la pandémie de COVID-19, et les résultats que le SRAS-CoV-2 reproduit dans le vasculature coronarien athérosclérotique ne concernent que les souches virales qui ont circulé à New York entre mai 2020 et mai 2021. Malgré ces limites,notre étude met en évidence la réponse hyperinflammatoire orchestrée par les macrophages de plaque infectés par le SRAS-CoV-2 et les cellules de mousse comme un lien mécaniste entre l’infection des vaisseaux coronaires athérosclérotiques et les complications cardiovasculaires aiguës du COVID-19.

Méthodes

L’approbation éthique pour l’utilisation de spécimens d’autopsie humaine a été obtenue auprès du conseil d’examen institutionnel (IRB) de NYU Langone Health (NYULH) (IRB i21-01587) conformément à toutes les réglementations éthiques pertinentes. Les patients soumis au CEA qui ont signé un consentement éclairé écrit ont été inscrits à l’étude ATHERO-IN approuvée par les IRB de l’École de médecine d’Icahn au Mont Sinaï (IRB 11–01427) et NYULH (IRB i21-00429). Les informations démographiques et les antécédents cliniques rapportés sont dépersonnalisés et couverts par le consentement des patients’ à publier de telles données conformément aux normes IRB 11–01427 et IRB i21-00429.

Échantillons d’autopsie coronaire de patients atteints de COVID-19

Spécimens d’artère coronaire fixés à la formol et en paraffine (n = 27 ) de huit patients décédés diagnostiqués avec COVID-19 ont été obtenus de NYULH et du NYU Grossman School of Medicine’s Center for Biospecimen Research and Development ( CBRD ). Des informations démographiques et des antécédents cliniques ont été obtenus à partir des dossiers médicaux de l’hôpital ( Tableau supplémentaire 1). Des données sur l’évolution clinique de l’infection et la pathologie associée au COVID-19 ont été obtenues à la fois dans les dossiers médicaux de l’hôpital et dans les rapports de pathologie d’autopsie ( Tableau supplémentaire 2).

NAccope hybridation in situ

Le test RNAscope 4-plex a été effectué sur des sections de tissu coronaire à l’aide du kit de réactif multiplex LS et du kit d’ancrage LS 4-plex RNAG ( ACD Bio-Techne ). Des sondes d’ARNscope spécifiques au SRAS-CoV-2 ont été utilisées pour visualiser l’ARNv du SRAS-CoV-2 codant pour la protéine S et pour détecter une réplication virale directe à l’aide d’une sonde sensorielle qui cible le brin antisens de le gène S. Des sondes de contrôle négatives et positives ont été utilisées pour évaluer l’intégrité de l’ARN tissulaire. Sondes d’ARNscope utilisées pour détecter CD68ACTA2 et PNR1 les transcriptions, le gène viral SRAS-CoV-2 S, le brin antisens du gène S et d’autres réactifs sont détaillés dans le tableau supplémentaire 5. Les sections de tissus ont été numérisées à un grossissement de ×40 dans le Vectra Polaris Automated Quantitative Pathology Imaging System à l’aide d’un flux de travail MOTIF. Pour les expériences in vitro, macrophages dérivés de cellules mononucléées du sang périphérique humain, cellules de mousse dérivées de macrophages, macrophages, les VSMC aortiques primaires et les VSMC chargées en cholestérol ont été infectées par le SRAS-CoV-2 avant d’effectuer le protocole RNAscope ISH Multiplex Fluorescent V2 Assay selon les instructions du fabricant’s. Les images ont été acquises avec un microscope Keyence BZ-X800.

Analyse d’hybridation in situ de RNAscope

Les images ont été annotées dans Phenochart visionneuse de diapositives entières (Akoya Biosciences). Les fichiers ‘.qptiff’ ont été estampillés pour le lot InForm sur Phenochart (version 1.1). Le démixage spectral de toutes les images a été effectué à l’aide de l’algorithme automatisé InForm’s. Les images estampillées ont été traitées par InForm (PerkinElmer, version 2.6), et les fichiers ‘component_data.tif’ ont été exportés pour la quantification en utilisant la plate-forme d’analyse d’image HALO (version 3.5.3577) et HALO AI (version 3.6.4134) (Indica Labs) en utilisant le module classificateur, module classificateur de réseau neuronal et module d’analyse spatiale. Les algorithmes utilisés étaient Area Quantification (version 2.4.2 et version 2.4.3), Area Quantification FL (version 2.3.3 et version 2.3.4), Deconvolution (version 1.1.7 et version 1.1.8) et FISH (version 3.2.3).L’IA a été formée par exemple pour classer les régions du tissu. Le classificateur d’apprentissage en profondeur Mininet formé à l’IA HALO a été utilisé pour classer la paroi coronaire et la graisse périvasculaire correspondante dans toutes les sections et pour éliminer l’autofluorescence de fond. La segmentation cellulaire a été réalisée en formant un classificateur de réseau de segmentation des noyaux AI avec des noyaux teints DAPI à la fois sur les images cousues de tissu coronarien entier et sur des expériences in vitro ’. La quantification des sondes était basée sur la couleur et le seuil d’intensité d’image constant, maintenant des paramètres constants à travers les échantillons. Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.Le classificateur d’apprentissage profond Mininet formé par HALO AI a été utilisé pour classer la paroi coronaire et la graisse périvasculaire correspondante dans toutes les sections et pour supprimer l’autofluorescence de fond. La segmentation cellulaire a été réalisée en formant un classificateur de réseau de segmentation de noyaux d’IA avec des noyaux colorés par DAPI sur les images cousues de tissu coronaire entier et les expériences in vitro. La quantification des sondes a été basée sur le seuillage de la couleur et de l’intensité de l’image constante, en maintenant les paramètres constants entre les échantillons. Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.Le classificateur d’apprentissage en profondeur Mininet formé à l’IA HALO a été utilisé pour classer la paroi coronaire et la graisse périvasculaire correspondante dans toutes les sections et pour éliminer l’autofluorescence de fond. La segmentation cellulaire a été réalisée en formant un classificateur de réseau de segmentation des noyaux AI avec des noyaux teints DAPI à la fois sur les images cousues de tissu coronarien entier et sur des expériences in vitro ’. La quantification des sondes était basée sur la couleur et le seuil d’intensité d’image constant, maintenant des paramètres constants à travers les échantillons. Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.La segmentation cellulaire a été réalisée en formant un classificateur de réseau de segmentation des noyaux AI avec des noyaux teints DAPI à la fois sur les images cousues de tissu coronarien entier et sur des expériences in vitro ’. La quantification des sondes était basée sur la couleur et le seuil d’intensité d’image constant, maintenant des paramètres constants à travers les échantillons. Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.La segmentation cellulaire a été réalisée en formant un classificateur de réseau de segmentation des noyaux AI avec des noyaux teints DAPI à la fois sur les images cousues de tissu coronarien entier et sur des expériences in vitro ’. La quantification des sondes était basée sur la couleur et le seuil d’intensité d’image constant, maintenant des paramètres constants à travers les échantillons. Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.Les algorithmes d’analyse d’imagerie HALO et le flux de travail d’analyse spatiale ont été utilisés pour quantifier le nombre de points positifs par cellule et la fréquence des cellules positives divisées par les cellules totales.

IHC

H&E et IHC chromogénique ont été réalisées par la CBRD NYULH. IHC pour la quantification des macrophages a été réalisé sur une plateforme Ventana Medical Systems Discovery Ultra en utilisant du CD68 anti-humain de lapin (ref. 65) (Systèmes Médicaux Ventana). Les images ont été acquises dans la pathologie numérique multimodale Vectra Polaris. L’évaluation histopathologique et les rapports de pathologie coronarienne ont été effectués par un pathologiste cardiovasculaire clinique en aveugle. Quantification du pourcentage de CD68+ la surface a été réalisée avec le module de comptage cellulaire hybride du microscope Keyence BZ-X800. CD68+ le nombre et la fréquence des cellules ont été obtenus à l’aide d’algorithmes d’analyse par imagerie HALO et de segmentation des noyaux AI.

Immunofluorescence

Les sections coronaires d’autopsie ont été colorées avec des anticorps primaires à 4 ° C pendant la nuit et avec des anticorps secondaires à température ambiante pendant 2 h, et les noyaux cellulaires ont été colorés avec du DAPI. L’autofluorescence a été éteinte avec TrueBlack Lipofuscin Autofluorescence Quencher ( Biotium ). Les macrophages et les cellules en mousse cultivés ont été colorés avec un anticorps anti-SARS-CoV-2 NP ( ProScience ) pendant la nuit à 4 ° C, suivi d’un anti-souris caprine Alexa Fluor 488 ( Invitrogène ) pendant 2 h à température ambiante. Des images ont été acquises à l’aide d’un microscope Keyence BZ-X800. Les anticorps primaires et secondaires utilisés sont répertoriés dans le tableau supplémentaire 5.

scRNA-seq d’artères carotides humaines

Des plaques carotides ont été obtenues auprès de patients atteints de CEA (n = 10 ) inscrit à l’étude Athero-IN ( IRB 11 – 01427 et IRB i21-00429 ). Les critères d’exclusion pour l’inscription des patients étaient les suivants: infection active, maladies auto-immunes, cancer actif ou récurrent et insuffisance rénale sévère nécessitant une dialyse. Tableau supplémentaire 4 résume les caractéristiques cliniques et démographiques de la cohorte d’étude. Les plaques ont été classées par un pathologiste cardiovasculaire clinique ( N.N. ) comme fibrocalcifique (n = 3 ) et fibroathérome (n = 4 ). Trois des 10 tissus de la plaque n’ont pas été classés en raison de l’insuffisance tissulaire.

Isolement cellulaire des tissus athérosclérotiques carotides

Des échantillons de plaque fraîche ont été placés immédiatement dans du DMEM (Gibco) et traités en 30 min pour obtenir une suspension unicellulaire selon un protocole de digestion décrit précédemment66. En résumé, les échantillons ont été lavés et digérés dans du DMEM contenant 10% de FBS (Gibco, 10082147); de la collagénase de type IV (Sigma-Aldrich, C5138) à une concentration finale de 1 mg ml−1; et DNase I (Sigma-Aldrich, DN25), hyaluronidase (Sigma-Aldrich, H3506), collagénase de type XI (Sigma-Aldrich, C7657) et collagénase de type II (Sigma-Aldrich, C6885), chacun à une concentration finale de 0,3 mg ml−1 pendant 40 min dans un doux MACS Octo Dissociator ( Miltenyi Biotec ). Le tissu digéré a été filtré séquentiellement à travers des déformateurs cellulaires de 70 μm et 40 μm ( Thermo Fisher Scientific, 22363547 et 22363548 ) et centrifugé à 300g pendant 8 min. Les cellules mortes ont été prélevées avec le kit EasySep Dead Cell Removal (Annexin V) (STEMCELL Technologies, 17899), et les leucocytes ont été isolés avec le kit EasySep Release Human CD45 Positive Selection Kit (STEMCELL Technologies, 100-0105) selon les instructions du fabricant’s. Les cellules vivantes ont été comptées avec le compteur de cellules automatique Cellometer Auto 2000 (Nexcelom), et les cellules ont été chargées dans le Chromium Controller (10x Genomics). les bibliothèques ScRNA-Seq ont été préparées en utilisant le réactif Chromium Single Cell 3′ Library v3, Gel Bead et Multiplex Kit and Chip Kit (10x Genomics). La quantité et la qualité de la banque d’ADN ont été mesurées avec le test fluorométrique Qubit dsDNA HS (Qiagen) et Bioanalyzer (Agilent) et séquencées sur un séquenceur NovaSeq 6000 (Illumina). les données SCRNA-seq de six échantillons ont été précédemment publiées66 et sont disponibles dans le GEO (GSE224273). Quatre échantillons supplémentaires ont été traités pour obtenir des données scRNA-seq supplémentaires ( GEO: GSE235437).

Analyse informatique de scRNA-seq coronaire et carotidien

Cell Ranger Single-Cell Software Suite (version 3.1.0) a été utilisé pour démultiplexer et aligner à la version de référence du génome humain GRCh38. Un total de 20 639 CD45+ les cellules ont été analysées de même que les résultats de Cell Ranger des données scRNA-seq du CEA avec une moyenne de 104 351 lectures moyennes par cellule et 3 128 comptes d’identificateurs moléculaires uniques médians (UMI) par cellule. Un ensemble de données scRNA-seq (GSE131780) comprenant des échantillons coronariens athérosclérotiques humains a été obtenu à partir du référentiel de données GEO15. Au total, 12 200 cellules coronaires provenant de sept échantillons de tissus prélevés sur quatre patients ont été analysées. Les sorties de Cell Ranger avaient une moyenne de 62 328 lectures moyennes par cellule et 2 703 comptes UMI médians par cellule.

Les matrices d’expression du gène filtré de sortie ont été analysées à l’aide du package Seurat ( version 4.0.3 )67. Les gènes mitochondriaux > 10% à > 20%, < 200 gènes et < 10 000 à < 20 000 UMI ont été filtrés. Les matrices d’expression génique ont été normalisées à l’aide de la fonction SCTransform, et une analyse robuste des composants principaux a été utilisée pour l’intégration. La fonction RunPCA a été utilisée pour calculer les 30 principaux composants principaux à l’aide de gènes exprimés de manière variable. FindIntegrationAnchors a servi à identifier les ancres entre les échantillons de carotides et a été entré dans la fonction IntegrateData pour corriger les effets de lot. Les cellules ont reçu un score de cycle cellulaire en utilisant la fonction CellCycleScoring pour régresser les variations indésirables. RunUMAP avec les fonctions FindNeighbors et FindClusters a été utilisé pour le clustering cellulaire. L’intégration / co-clustering de cellules uniques carotides et coronaires a été réalisée à l’aide de Harmony68. La réduction de la dimensionnalité générée par Harmony a été utilisée pour calculer l’approximation et la projection uniformes des variétés ( UMAP ) et le regroupement basé sur des graphiques avec une résolution de 0,7. FindAllMarkers a été utilisé pour trouver des gènes exprimés différemment ( DEGs ) en utilisant le test statistique de la somme de rang de Wilcoxon, et les principales populations cellulaires ont été annotées en utilisant des DEG et des gènes marqueurs canoniques. Une analyse sous-clusternelle des cellules myéloïdes a été effectuée avec la même approche décrite ci-dessus. Package MiloR ( version 1.3.1 )55 a été utilisé pour tester l’abondance différentielle entre la carotide et la coronaire. Les quartiers cellulaires ont été définis sur un k-voisin le plus proche ( kNN ) graphique (k = 20, d = 30), et l’essai de l’abondance différentielle a été fait en utilisant un cadre de modèle linéaire général binomial négatif. Les quartiers cellulaires ont été annotés en fonction de leurs grappes, et l’abondance différentielle a été exprimée sous forme de changements de pli logarithmique (FC) affichés dans une parcelle de terrain humide.

Analyse des données GTEx

L’analyse de l’expression génique des facteurs d’entrée du SRAS-CoV-2 dans l’aorte, les artères coronaires et tibiales, le cœur (appendice auriculaire et ventricule gauche), le poumon et le sang total a été réalisée à l’aide des données GTEx (version V8, numéro d’accession dbGaP phs000424.v8.p2), qui contient 17 382 échantillons de tissus ARN-seq au total provenant de 948 donneurs décédés (67,1% d’hommes). La cohorte comprend des ascendants Caucasiens (84,6%), Afro-Américains (12,9%), Indiens d’Amérique (0,2%), Asiatiques (1,3%) et inconnus (1,1%). Les causes de décès enregistrées sont les lésions traumatiques, les maladies cérébrovasculaires (>22%) ou les maladies cardiaques (>40%). Les résultats sont présentés sous forme d’échelle logarithmique de transcrits par million (log10 TMP+1‘).

Analyse computationnelle des données scRNA-seq murines

Séquençage des données de la réf. 16 ont été extraits du numéro d’adhésion de BioProject PRJNA626450. Le contrôle de la qualité des données scRNA-seq a été effectué en utilisant FastQC (version 0.11.7). Les billes ont été alignées sur le génome de référence GRCm39 (mm39) en utilisant STAR (version 2.6.1d). FeatureCounts du paquet sous-lu (version 1.6.3) a été utilisé et les comptes normalisés ont été utilisés pour l’analyse en aval en utilisant le paquet Seurat R (version 4.3.0). Des gènes très variables ont été identifiés en utilisant la fonction FindVariableFeatures. La fonction RunUMAP avec les paramètres par défaut a été utilisée avec les fonctions FindNeighbors et FindClusters pour le clustering de cellules. L’analyse différentielle de l’expression génique a été réalisée à l’aide de la fonction FindMarkers pour identifier les différences entre les rapporteurs de Tomates monocolores (Myh11-CreERT2, Rosa26tdTomato/Tomtdato, ApoE−/−les souris ) ont nourri un régime riche en graisses ( 21% de matières grasses laitières anhydres, 19% de caséine et 0,25% de cholestérol ) pendant 18 semaines par rapport aux souris témoins. La méthode Benjamini – Hochberg a été appliquée pour contrôler le taux de fausses découvertes ( FDR ).

Expériences en biosécurité niveau 3

Des études impliquant une infection au SRAS-CoV-2 ont été approuvées par le comité institutionnel de biosécurité ( IBC21-000079 ) de la NYU Grossman School of Medicine. Toutes les procédures de niveau 3 de biosécurité ont été menées conformément au manuel de biosécurité et aux procédures opérationnelles standard de l’installation de haute maîtrise de la NYU Grossman School of Medicine.

Cellules et virus

Les cellules Vero E6 ( Collection de cultures de type américain, CRL-1586 ) ont été maintenues dans des milieux de culture DMEM contenant 10% de FBS ( Gibco ), 2 mM L-glutamine et 100 U ml− 1 pénicilline – streptomycine. Vero E6 exprimant la protéase transmembranaire, la sérine 2 et l’enzyme de conversion de l’angiotensine humaine 2 ( Vero E6-TMPRSS2-T2A-ACE2 ) ont été obtenus à partir des ressources BEI ( NR-54970 ). Les cellules Vero E6-TMPRSS2-T2A-ACE2 ont été cultivées en milieu DMEM avec 4 mM L-glutamine, 4 500 ml de glucose, 1 mM de pyruvate de sodium et 1 500 mg L− 1 bicarbonate de sodium, 10% FBS et 10 μg ml− 1 puromycine. Toutes les cellules ont été vérifiées exemptes de contamination par les mycoplasmes.

L’isolat SRAS-CoV-2 USA-WA1 / 2020 ( BEI Resources, NR52281 ) a été amplifié une fois dans les cellules Vero E6 infectées par une multiplicité d’infection ( MOI ) de 0,01 comme décrit précédemment69. Le virus a été collecté à 72 hpi lors de l’observation de l’effet cytopathique. Les débris ont été retirés par centrifugation et passage à travers un filtre de 0,22 μm, et le surnageant a ensuite été aliquoté et stocké à − 80 ° C. Le titre viral a été calculé par dosage de plaque sur les cellules de Vero E6 et informé en tant qu’unités formant des particules par millilitre ( PFU ml1‘). Les stocks de virus ont été séquencés lors de la production de stocks viraux. Amplicon PCR couvrant le gène S (FW: gttcagagtttattctagtgcgaataattgcacttttg, RV: gcagtaaggatggctagtgtaactagcaagaataccac) a été purifié à l’aide du Nucleospin PCR and Gel Extraction Kit (Macherey-Nagel) et du Sanger séquencé (GENEWIZ) avec les amorces suivantes (FW: ggttttattgttactttcc et FW: ctaaggttaattttttc). icsARS-CoV-2 mNG virus rapporteur a été obtenu à partir de l’UTMB World Reference Center for Emerging Viruses and Arbovirus21.

Infection in vitro du SRAS-CoV-2 par des cellules primaires humaines

Les monocytes primaires humains ont été différenciés en macrophages en présence d’un facteur de stimulation des colonies de macrophages humains de 20 nM ( M-CSF, PeproTech ) dans des milieux de culture DMEM complétés par 10% FBS, 2 mM L-glutamine et 100 U ml− 1 pénicilline – streptomycine pour 5 d. Les macrophages ont ensuite été traités avec 10 μg ml− 1 de Dil-oxLDL ou ox-LDL ( Invitrogène ) pendant 1 h avant l’infection et conservé tout au long de l’expérience. Les cellules musculaires lisses aortiques humaines ( PromoCell, C-12533 ) ont été cultivées dans un milieu de croissance des cellules musculaires lisses complet avec 0,05 ml / ml FCS, 0,5 ng ml− 1 facteur de croissance épidermique humain recombinant, 0,2 ng ml− 1 facteur de croissance du fibroblast basique humain recombinant et 5 µg ml− 1 insuline humaine recombinante et traitée avec 10 µg ml− 1 Cholestérol – méthyl-β-cyclodextrine ( Sigma-Aldrich ) pendant la nuit avant l’infection par l’isolat du virus SRAS-CoV-2 USA-WA1 / 2020 au MOI 0,1 dans les milieux infectieux avec 2% de FBS. Les cellules infectées par la moquerie ont été utilisées comme témoins. Les surnageants de culture cellulaire ont été inactivés avec irradiation UV pendant 15 min et stockés à − 80 ° C. Les cellules ont été collectées dans TRIzol ( Invitrogène ) ou 10% de formol tamponné. Les macrophages et les cellules en mousse ont été traités avec du trifluoroacétate d’EG00229 ( Tocris, 6986 ) à une concentration finale de 100 μM pendant 1 h avant l’infection.

Coloration lipidique avec Oil Red O

VSMC traités avec 10 µg ml− 1 de cholestérol – méthyl-β-cyclodextrine ou véhicule pendant 48 h ont été fixés avec 10% de formol tamponné pendant 1 h et incubés avec 60% d’isopropanol pendant 1 min. Coloration avec une solution de travail O ( Sigma-Aldrich ) a été effectuée pendant 20 minutes avant la contre-tache d’hématoxyline pendant 1 min. Des images ont été acquises avec un microscope Keyence BZ-X800.

Infection ex vivo au SRAS-CoV-2 d’explosants vasculaires humains

Les spécimens de plaque carotidienne ont été décongelés, coupés en morceaux ( environ 3 × 3 mm ) et cultivés dans des milieux de culture DMEM complétés par 10% de FBS, 2 mM L-glutamine et 100 U ml− 1 pénicilline – streptomycine pendant 2 h. Les spécimens tissulaires ont été infectés par 105 PFU ml1de l’isolat USA-WA1 / 2020 du virus SRAS-CoV-2. Les tissus non infectés ont été utilisés comme témoins. Des échantillons de milieux culturels ont été prélevés à 24 hpi, 48 hpi et 72 hpi et inactivés par irradiation UV pendant 15 min. Les spécimens tissulaires ont été fixés pendant la nuit avec 4% de paraformaldéhyde pour l’immunofluorescence ou 3% de glutaraldéhyde pour la microscopie électronique. Les tissus utilisés pour l’ARN-seq en vrac ont été stockés dans 1 ml de réactif TRIzol. Pour les expériences de blocage du PNR-1, les tissus ont été prétraités avec un agent bloquant le PNR1 ( EG00229 trifluoroacétate ) à une concentration finale de 100 μM pendant 1 h avant l’infection.

Quantification infectieuse des particules par dosage de plaque

Des dilutions décuplées de milieux de culture conditionnés ont été ajoutées aux monocouches de cellules Vero E6-TMPRSS2-T2A-ACE2 pendant 1 h et secouées doucement toutes les 15 minutes. Après incubation, les cellules ont été superposées avec 0,8% d’agarose dans du DMEM contenant 2% de FBS et incubées pendant 36 h. Après la fixation, les bouchons d’agarose ont été retirés et les plaques ont été visualisées par coloration de solution de cristal violet. Les plaques ont été comptées et les résultats ont été exprimés en PFU ml1. Des tests de plaques utilisant des cellules Vero E6 ont été effectués avec une période d’incubation de 72 h.

Silençage du PNR1 dans les macrophages humains et les cellules en mousse

La réduction transitoire du PNR1 a été réalisée à l’aide d’un pool de génies pré-conçu siRNA FlexiTube pour le silencieux NRP1 ( Qiagen, GS8829; Hs_NRP1_8, ACGGTCATAGACACCATA; Hs_NRPAC_7, CACGCGATTCATCATP, CTCCCAGATCACATCATCCAA ) et contrôle négatif non ciblant ( Qiagen, AllsStars Negative Control siRNA ). En bref, 3 µl de Lipofectamine RNaiMAX ( Invitrogène ) et siRNA oligos 10 nM concentration finale ont été ajoutés à un volume final de 200 µl d’OptiMEM réduit le milieu sérique ( Gibco ). Le mélange a été incubé à température ambiante pendant 20 min. Les cellules plaquées ( 60 – 80% de confluence ) ont été transfectées en ajoutant des oligos/Complexes Lipofectamine RNaiMAX dans un volume final de 1 ml avec DMEM sans sérum ni antibiotiques pendant la nuit ( ~ 16 h ) avant de remplacer le milieu par un milieu DMEM complet par 10% FBS pendant 24 h. Après 24 h,la moitié des cellules ont été traitées avec 10 µg ml− 1 oxLDL pendant 2 h avant l’infection par le virus SRAS-CoV-2 USAWA1 / 2020 isole MOI 0,1 dans le milieu infectieux ( 2% FBS DMEM ) pendant 24 h. Les cellules ont été récoltées pour l’analyse de l’ARN et des protéines, et les surnageants de culture cellulaire ont été inactivés aux UV pendant 15 minutes. Les cellules ont été fixées avec 10% de formol tamponné pendant 1 h avant la coloration du NAc.

Quantification des protéines et analyse Western Blot

Les lysats de protéines, obtenus en utilisant un tampon RIPA contenant de la phosphatase et un cocktail d’inhibiteurs de protéase (100×), ont été traités pour quantifier la concentration de protéines à l’aide du Pierce BCA Protein Assay Kit. Les anticorps suivants ont été utilisés pour l’analyse par western blot: anticorps monoclonal de lapin anti-NRP1 (Cell Signaling Technology), anticorps monoclonal de souris anti-actine (Sigma-Aldrich) et anticorps secondaires anti-lapin et anti-souris conjugués HRP (ProteinSimple). Toutes les informations sur les réactifs sont répertoriées dans le Tableau supplémentaire 5. Des marqueurs de poids moléculaire et des échantillons ont été exécutés à travers le système ProteinSimple WES, et les images ont été analysées à l’aide du logiciel Compass for Simple Western (version 6.2.0).

RT–qPCR

L’ARN a été extrait à l’aide du réactif TRIzol et des kits de microprep d’ARN à base de zol direct ( Zymo Research ) ou du mini kit RNAeasy ( Qiagen ). Transcription inverse ( Kit de transcription inverse de l’ADNc à haute capacité, Biosystèmes appliqués ) a été effectuée à 37 ° C pendant 1 h, et la réaction a été arrêtée par chauffage à 95 ° C pendant 5 min et maintenez à 4 ° C. RT – qPCR a été réalisée à l’aide d’amorces spécifiques au gène ( Tableau supplémentaire 5) en utilisant le TaqMan Fast Advanced Master Mix et le système de détection Applied Biosystems QuantStudio 6 Pro. Les conditions de cycle thermique étaient de 50 ° C pendant 2 min, suivi d’une étape à 95 ° C pendant 2 min et 40 cycles à 95 ° C pendant 1 s et 60 ° C pendant 20 s. La quantification relative du gène NP SRS-CoV-2 a été calculée à l’aide du 2− ΔΔCt méthode dans la version 2.6 du logiciel de conception et d’analyse. Les FC dans l’expression des gènes ont été normalisés en gène de contrôle d’entretien ménager et logés calculésdixFC par rapport à l’échantillon témoin ( 2 h après l’inoculum viral ). Pour le silencieux NRP1 dans les expériences in vitro, contrôle de la qualité, FC dans l’expression génétique du PNR1 le gène cible a été normalisé au GAPDH gène de contrôle de l’entretien ménager. La quantification relative a été effectuée à l’aide du 2− ΔΔCt méthode et les échantillons ont été normalisés par les témoins endogènes.

RNA-seq en vrac

L’ARN des macrophages primaires et des cellules de mousse a été extrait à l’aide du réactif TRIzol et des Kits de Microprep à ARN Direct-zol suivant les instructions du fabricant. L’ARN total du tissu athérosclérotique humain a été isolé à l’aide du réactif de lyse QIAzol (Qiagen) et de l’homogénéisateur doux MACS Octo Dissociator (Miltenyi Biotec), combiné avec le nettoyage de l’ARN à l’aide du RNAeasy Mini Kit (Qiagen). Le contrôle qualité a été réalisé avec les kits Agilent RNA 6000 Nano et Pico (Agilent Technologies) en utilisant le système Bioanalyzer Agilent 2100. Pour les expériences in vitro, la préparation de la bibliothèque poly(A) a été réalisée en utilisant Illumina Stranded ARNm Preparation and Ligation (Illumina). Pour les expériences ex vivo sur plaque athéroscléreuse humaine, le kit de préparation de la bibliothèque Revelo RNA-Seq High Sensitivity a été utilisé (Tecan). Les bibliothèques ont été quantifiées à l’aide du KAPA Library Quantification Kit (Roche),regroupé à une concentration équimolaire de 2 nM et séquencé à l’aide d’un séquenceur Illumina NovaSeq 6000.

Traitement, analyse et visualisation des données ARN-seq

Le contrôle de la qualité des données ARN-seq a été effectué à l’aide de FastQC2 ( version 0.11.7 ). Les lectures séquencées brutes ont été coupées à l’aide de la version 0.20.1 ( fastp3 pour le contrôle qualité des bases et pour éliminer les adaptateurs de séquençage. Les lectures brutes ont été alignées à l’aide de la version 2.6.1d ( de STAR à l’homme combiné )Homo sapiens) assemblage de génomes GRCh38 du Consortium de référence de génome ( GCA_000001405.15 GCF_000001405.26 ) et SRAS-CoV-2 Isolat de Washington ( USA WA1 / 2020 ) génome (: MN985325.1). Le nombre d’expressions au niveau du gène a été calculé avec la fonction featureCounts dans le package Subread ( version 1.6.3; paramètres: -g gene_id -s 2 ) en utilisant les annotations du gène humain de la version 33 de GENCODE. L’expression différentielle a été effectuée à l’aide du package R DESeq2 ( version 1.30.1 ). Pour modéliser les différences d’expression génique entre les macrophages primaires et les cellules en mousse infectés par le SRAS-CoV-2, un modèle comprenant l’état de l’infection, le point de temps et le donneur en tant que variables dépendantes a été utilisé. Pour identifier les différences d’expression génique entre les macrophages infectés et les cellules en mousse infectées, un modèle comprenant le type de cellule, le point de temps et le donneur comme variables dépendantes a été utilisé. Pour analyser la variation de l’expression des gènes à travers les points de temps et l’état de l’infection dans les macrophages et les cellules en mousse, nous avons utilisé un modèle qui incorporait l’état de l’infection, le point de temps,donneur et interaction entre le statut d’infection et le point de temps en tant que variables dépendantes pour chaque type d’échantillon séparément. Les scores IFN et SRAS-CoV-2 ont été calculés comme log2 valeurs des gènes de réponse IFN et des gènes SRAS-CoV-2 comparant la réponse des cellules macrophages et moussants à 0 hpi, 2 hpi, 8 hpi, 24 hpi et 48 hpi. Données standardisées (z-les cœurs ) ont été calculés pour chaque caractéristique en soustrayant la moyenne estimée et en divisant par l’estimation s.d. Pour le clustering hiérarchique, les données ont été tracées à l’aide du package pheatmap ( version 1.0.12 ) dans R. Une analyse d’expression différentielle des échantillons de plaque athérosclérotique infectés par le SRAS-CoV-2 a été effectuée à l’aide du paquet R DESeq2 avec le point de temps et le donneur inclus comme variables dépendantes. Pour l’analyse hiérarchique des regroupements, les valeurs normalisées ont été normalisées et tracées à l’aide du paquet phéatmap ( version 1.0.12 ) dans R. P les valeurs ont été ajustées en utilisant la correction Benjamini–Hochberg et désignées comme un astérisque. L’analyse de l’enrichissement des ensembles de gènes à l’aide de Reactome Knowledgebase 2022 et Gene Ontology Biological Process 2021 des 300 meilleurs DEG a été réalisée à l’aide d’Enrichr (https://maayanlab.cloud/Enrichr/‘)70,71. Les diagrammes à barres représentent le score combiné de 10 voies les plus pertinentes ayant une signification statistique (*P < 0,05, **P < 0,01; ***P < 0,001).

Sécrétion de protéines de cytokine et de chimiokine

Un criblage de 48 cytokines et chimiokines humaines a été réalisé en utilisant des surnageants de culture inactivés aux UV en utilisant le Bio-Plex Pro Human Cytokine Screening Panel (Bio-Rad) et la plateforme Luminex 200 du Immune Monitoring Laboratory Division of Advanced Research Technologies de la NYU Grossman School of Medicine. Les données de Luminex ont été transformées; des différences statistiquement significatives ont été calculées en utilisant des données non appariées recto-verso t– tests; et P les valeurs ont été ajustées en utilisant la correction Benjamini–Hochberg. La correction empirique des lots de Bayes (Combat) a été utilisée pour supprimer les effets de lot avant de transformer les données. L’analyse statistique a été réalisée en utilisant R (version 4.0.3). Cytokines montrant le journal2FC > 0 ont été régulés à la hausse, et les cytokines montrant log2FC < 0 ont été dérégulées. Les concentrations de TGF-Invitrogen-1 et de Caspase-8 ont été mesurées par ELISA (Invitrogen) dans le surnageant de milieux de culture clarifiés, selon les instructions du fabricant.

Microscopie électronique transmission

Après 48 hpi et 72 hpi, des échantillons athérosclérotiques infectés par le SRAS-CoV-2 ex vivo ont été fixés avec 3% de glutaraldéhyde/PBS (pH 7,4) à 4 °C. Des échantillons ont été préparés pour l’évaluation au microscope électronique par la NYU Grossman School of Medicine’s Microscopy Laboratory selon les procédures opératoires standard. Les échantillons ont été examinés par microscopie électronique à transmission. Les grilles stockées ont été imagées avec un microscope électronique à transmission Talos L120C et enregistrées à l’aide d’une caméra Gatan OneView (résolution 4 K × 4 K) avec le logiciel Digital Micrograph (Gatan Microscopy Suite).

Analyse statistique

Les analyses statistiques non décrites ci-dessus ont été effectuées à l’aide de la version 9.0 de GraphPad Prism, et les détails sont inclus dans les légendes des figures. Statistiques P les valeurs ont été calculées et déclarées sur les graphiques, et P < 0,05 a été considéré comme significatif.

Résumé du rapport

De plus amples informations sur la conception de la recherche sont disponibles dans le Résumé des rapports du portefeuille Nature lié à cet article.

Disponibilité des données

les données scRNA-seq des six artères carotides humaines ont déjà été publiées et sont disponibles dans le GEO (GSE224273). Quatre plaques carotides supplémentaires ont été traitées pour obtenir des données sc-RNasseq déposées dans le GEO (GSE235437). des lésions coronariennes des données scRNA-seq ont été obtenues auprès du GEO (GSE131780). Les données de l’ARN-seq en vrac provenant des macrophages et des expériences sur les cellules en mousse et les tissus de plaque infectés par le SRAS-CoV-2 sont déposés dans le GEO (GSE235437). Les données GTEx utilisées sont la version V8, numéro d’accès dbGAP phs000424.v8.p2, et disponible sur le portail GTEx (https://gtexportal.org/home). Murine scRNA-seq d’après réf. 16 ont été extraits du numéro d’accès de BioProject PRJNA626450. Humain (Homo sapiens) l’ensemble du génome GRCh38 ( hg38 ) a été obtenu auprès du consortium de référence du génome ( GCA_000001405.15 GCF_000001405.26 ). L’isolat de SRAS-CoV-2 à Washington ( WA1 / 2020 ) génome a été obtenu à partir du référentiel NIH ( GenBank: MN985325.1). Le réactif suivant a été déposé par les Centers for Disease Control and Prevention et obtenu par BEI Resources, NIAID, NIH: SARS-Related Coronavirus 2, Isolate hCoV-19 / USA-WA1 / 2020, NR-52281. Le réactif suivant a été obtenu par BEI Resources, NIAID, NIH Cercopithecus aethiops Cellules Épithéliales du Rein Exprimant la Protéase Transmembranaire, la Sérine et l’Angiotensine Humaine-Convertissant l’Enzyme 2 (Vero E6-TMPRSS2-T2A-ACE2, NR-54970). Toutes les autres données à l’appui des résultats de cette étude sont incluses dans l’article principal et les fichiers associés. Les fichiers de données sources sont disponibles sur GitHub à l’adresse suivante https://github.com/giannarelli-lab/SARS-CoV-2-infection-triggers-pro-atherogenic-inflammatory-responses-in-human-coronary-vessels.

Disponibilité du code

Le code utilisé pour l’analyse des données est disponible sur GitHub https://github.com/giannarelli-lab/SARS-CoV-2-infection-triggers-pro-atherogenic-inflammatory-responses-in-human-coronary-vessels.

 

 

 

 

 

 

En Chine, quand les jeunes citadins plongent les mains dans la terre

Des citadines s’affairent dans un potager du district de Wuqiang, situé dans la province du Hebei, le 23 décembre 2019.

“Dans le prix, tout est inclus, de l’achat des graines au bêchage, et même l’envoi des légumes par voie postale pour qui n’a pas le temps de venir les récolter.”

Source : En Chine, quand les jeunes citadins plongent les mains dans la terre

Reportage.

En Chine, quand les jeunes citadins plongent les mains dans la terre

Bêcher, planter, biner, cueillir… Une nouvelle génération de Chinois découvre les joies du jardinage dans des potagers partagés qui se multiplient en banlieue des métropoles. Avec des formules à la carte censées répondre, au plus près, à leurs besoins de grand air et d’authenticité.

Comme une nostalgie de la vie à la campagne, la classe moyenne émergente, issue des métropoles chinoises, s’est trouvé une nouvelle passion : les jardins partagés.

À Pékin, à Shanghai, à Canton ou à Shenzhen, si on s’étonne de trouver en semaine, aux heures de bureau, des centres commerciaux toujours bondés, on ne saurait trop dire pourquoi, le week-end, on retrouve ces mêmes citadins se précipiter en banlieue pour se mettre au vert.

“Chaque week-end, c’est la foule des grands jours sur les parcelles horticoles de la ferme”, confirme M. Song, qui dirige le domaine agricole de Baiwang, à Pékin. Chaque année au mois de mars, décrit-il, un peu avant le début du bêchage, les candidats à la location d’une parcelle potagère font la queue pour s’inscrire. Il ne peut malheureusement pas satisfaire toutes les demandes, même si sa ferme est le plus grand domaine agricole du district pékinois de Haidian.

Ces jardiniers du dimanche ont un profil type : des familles avec enfants, qui souhaitent “avoir une expérience de la vie à la campagne et se rapprocher de la nature”.

Zhai Fang, une mère de famille d’une trentaine d’années, loue 800 yuans [100 euros] par an un terrain de 20 m², qui suffit à alimenter sa famille en légumes à tous les repas tout au long de l’année :

“Les légumes qu’on cultive soi-même sont plus frais, on peut les consommer les yeux fermés.”

Soucieux de sécurité alimentaire et de qualité nutritionnelle, les ménages avec enfants de la classe moyenne plébiscitent nettement ces jardins partagés. Mais certains, plus jeunes, s’y mettent aussi.

Forfait “tout en un”

Située dans le district de Haidian, la ferme de Baiwang jouxte le quartier de Xi’erqi, où se concentrent les locaux de grandes entreprises du Net. Logique, donc, que chaque week-end, des visiteurs à l’emploi du temps très minuté viennent s’y essayer à la culture potagère. Ces représentants d’une nouvelle classe moyenne, plutôt jeunes, s’appliquent à prendre en photo le moindre légume, le moindre fruit. “Ils bossent comme des dingues toute la semaine, explique M. Song. Ils ne peuvent venir ici que le week-end.”

La ferme leur propose des forfaits “tout en un”, afin de répondre à la demande de cette clientèle qui désire posséder son propre potager, mais dont les aspirations bucoliques se doublent d’une méconnaissance totale du jardinage.

Les plateformes de réseaux sociaux comme Xiaohongshu (appelé “RED”, à l’international) regorgent d’annonces de domaines agricoles situés en banlieue des grandes villes qui proposent ce genre de service forfaitaire :

“Dans le prix, tout est inclus, de l’achat des graines au bêchage, et même l’envoi des légumes par voie postale pour qui n’a pas le temps de venir les récolter.”

Pour ces services, les tarifs vont de 5 000 à 6 000 yuans pour une année [soit de 640 à 770 euros].

Grâce à cette offre très bien pensée, les jeunes “propriétaires terriens” qui louent une parcelle n’ont pas besoin de suer à grosses gouttes pour arracher les mauvaises herbes ou bêcher la terre, ni de faire de deux à trois heures de trajet quasi quotidien pour surveiller leurs plantations. Il leur suffit de venir faire un petit tour en voiture le week-end lorsqu’ils ont du temps libre, histoire d’avoir, avec leur potager à eux, un “contact direct avec la terre, de sentir le parfum naturel des fleurs et de l’herbe, et de cueillir de leurs propres mains les fruits et les légumes les plus frais qui soient”.

Un jeune homme observe la croissance de légumes dans une serre située près de la mégapole de Chongqing, le 5 septembre 2023.
Un jeune homme observe la croissance de légumes dans une serre située près de la mégapole de Chongqing, le 5 septembre 2023. PHOTO CFOTO/NURPHOTO/AFP

Un nouveau marqueur de classe sociale

De nombreux domaines agricoles ont également mis en place des séances de cueillette et aménagé des terrains de camping ; parfois, ils proposent même des activités éducatives parents-enfants. La souscription à une offre forfaitaire permet à la nouvelle classe moyenne de profiter de tous ces services à la fois. C’est en train de devenir le “nouveau marqueur” de cette classe sociale.

“À partir d’un certain âge, le jardinier qui sommeille en chaque Chinois se réveille…”

C’est ainsi que Zhai Fang justifie sa brusque envie de “louer un lopin de terre”. En 2022, elle a dû rester longtemps confinée. Comme elle s’ennuyait, elle s’est mise à cultiver de l’oignon vert et de l’ail sur son balcon, après s’être renseignée à ce sujet. “Avoir son propre potager, c’était l’assurance d’avoir des produits frais et sains, et les enfants ont adoré. C’était un bon moyen de passer le temps.” Ainsi est né son amour pour le jardin potager ! Et quand elle n’a plus eu besoin de rester enfermée chez elle, elle s’est intéressée à la ferme de Baiwang, située à deux pas de chez elle.

LIRE AUSSI : Chine. Pendant le confinement, un jeune Shanghaïen dit avoir recensé 86 variétés de plantes

Elle a eu le choix entre louer son potager de 20 m² contre un loyer annuel de 800 yuans [une centaine d’euros] ou déléguer la gestion de sa parcelle pour 5 000 yuans [640 euros]. Avec deux enfants, elle a préféré la première option, qui permet d’“avoir les mains dans la terre pour produire à manger”. Grâce au rendement de son petit potager, elle a pu réduire ses dépenses alimentaires quotidiennes. Elle avait, certes, pu se faire la main grâce à ses petites plantations sur son balcon. Et la présence de sa mère, venue habiter avec la famille, a fini de la convaincre : “C’est une experte en jardinage, et cela lui permet de passer le temps agréablement.”

Formule “économique”

Ainsi, avec sa mère et ses enfants, Zhai Fang se rend deux ou trois fois par semaine dans son petit potager, plus le week-end pour se détendre avec son mari. Elle a fait ses comptes : “Grâce aux concombres, aux salades et aux tomates qu’on y récolte toute l’année, je peux quasiment couvrir les besoins quotidiens en légumes de notre foyer de cinq personnes.” Chaque mois, elle économise ainsi de 400 à 500 yuans (de 50 à 65 euros) en fruits et légumes frais. “C’est plus intéressant que d’aller faire ses courses chez Sam’s Club [du nom d’une enseigne américaine de magasins-entrepôts] !”

LIRE AUSSI : Idées. Les jardins, nouveaux lieux des utopies politiques

En juillet, son mari a récolté tout un tas de concombres. “Il en a rempli deux grands paniers ! Comme on n’aurait jamais pu tout manger, on les a finalement vendus aux habitants de notre résidence au prix de 4 yuans le kilo [50 centimes d’euro]. Assez pour rentrer un peu dans nos frais !” raconte Zhai Fang en riant.

Comme elle, Jin Lu, qui approche la trentaine, loue pour 1 500 yuans [190 euros] une parcelle de 100 m² dans des jardins partagés de l’arrondissement de Minhang, à Shanghai. Une formule à la fois “économique” et bucolique.

Les “joies simples” de la campagne

“Dans la municipalité de Shanghai, le moindre séjour à la ferme coûte de 200 à 300 yuans par personne [environ 30 euros], précise-t-elle. Alors que c’est gratuit quand on va visiter son propre jardin potager.” Sa famille aspirait d’autant plus à jouir des “joies simples” de la campagne qu’elle vit entourée de béton et d’acier, ajoute-t-elle.

Jin Lu a par ailleurs calculé qu’avec la location d’un potager elle pouvait “faire d’une pierre trois coups” : d’une part, elle dispose de légumes en permanence, qui ont poussé en plein air, et peuvent être consommés sans souci grâce à leurs bonnes qualités nutritives ; d’autre part, en y emmenant son enfant tous les week-ends pour s’occuper du jardin, c’est l’occasion de faire un peu d’exercice ; et, par-dessus tout, c’est un nouveau lieu de sortie pour “faire prendre l’air” à son enfant.

“Il adore aller au potager. Il participe en apprenant, peu à peu, à réaliser différentes tâches – bêcher, semer, arroser, ajouter de l’engrais, désherber, biner, cueillir…”

Pour Jin Lu, ce champ de légumes est comme un “lieu d’apprentissage naturel entre parent et enfant”. On y fait l’expérience des difficultés du travail agricole, tout en apprenant à chérir la nourriture. “Quand je travaille ici avec lui, c’est plus intéressant et on échange davantage que lorsque je dois l’aider pour ses devoirs.”

La cueillette des tomates dans un jardin potager situé en banlieue de Yibin, une ville située aux sources du fleuve Yangtsé, dans l’ouest de la Chine, le 10 juillet 2023. JIANG HONGJING/XINHUA/AFP
La cueillette des tomates dans un jardin potager situé en banlieue de Yibin, une ville située aux sources du fleuve Yangtsé, dans l’ouest de la Chine, le 10 juillet 2023. JIANG HONGJING/XINHUA/AFP PHOTO JIANG HONGJING/XINHUA/AFP

Les tracas s’effacent

Les membres de la classe moyenne émergente, plus jeunes et moins disponibles, sont souvent séduits par la formule à 5 000 ou 6 000 yuans par an, où l’on délègue la gestion d’un jardin de 40 m².

“Cultiver des légumes n’est pas l’objectif premier ; pouvoir manger des légumes frais et bio n’est que la cerise sur le gâteau. Ce qui compte avant tout, c’est de pouvoir venir s’allonger dans son petit jardin le week-end, dans un cadre enchanteur de cours d’eau et de montagnes verdoyantes, bercé par le chant des oiseaux et le gargouillis des ruisseaux. Un endroit paradisiaque à deux pas de chez soi.”

“Tous les tracas d’une semaine de travail s’effacent soudainement dès que j’empoigne ma bêche”, sourit Yang Zhang, un cadre moyen âgé de 28 ans, qui travaille depuis cinq ans dans une société du Net à Pékin. Le week-end, il prend volontiers sa voiture pour venir “jouer au jardinier le temps d’une journée” sur sa petite parcelle potagère située en périphérie.

Avec leurs formules “tout compris” adaptées aux besoins des personnes, les jardins partagés offrent de véritables stations de recharge mentale pour ces représentants de la nouvelle classe moyenne qui, comme Yang Zhang, manquent non pas d’argent mais de temps libre. Et qui aspirent à “se rendre dans un endroit paradisiaque pour se remettre en forme”, pour reprendre ses termes.

Le week-end, il apprend à bêcher sa parcelle et à tailler les plantes sur les conseils des encadrants de la ferme, ou fait un tour dans sa propre serre pour découvrir les nouvelles pousses qui viennent de sortir. Bien qu’il réside depuis de nombreuses années à Pékin, il n’avait pas réussi à y trouver ses marques. En plus de l’achat d’un logement, devenir “propriétaire foncier” d’un petit lopin de terre, dans une ferme en banlieue, permet aux gens comme lui de mieux s’enraciner dans une grande ville.

Un soir, après avoir bossé jusqu’à 22 heures, Yang Zhang a roulé en voiture jusqu’à la ferme pour décompresser. Là, en pleine nuit, il s’est mis à cueillir des tomates cerises qu’il a englouties machinalement, séduit par leur goût sucré et acidulé. “Ce sont les meilleures tomates que j’ai mangées de toute ma vie !” s’exclame-t-il.

Le temps plutôt que l’argent

Si le principe des jardins partagés [dans les grandes villes chinoises] n’est pas nouveau, ce qui se développe, c’est bien cette possibilité d’en déléguer la gestion pour quelques milliers de yuans par an, très appréciée des nouveaux citadins.

À Pékin, par exemple, si le lopin de terre potagère brut se loue 40 yuans le m2 [5 euros], le prix s’élève à 125 yuans [16 euros] dans le cas d’un potager avec services “tout compris”. Ce n’est certes pas donné, mais le tarif reste acceptable pour cette nouvelle génération – peut-être parce qu’elle a fait sien l’adage selon lequel “ce qui est précieux, c’est le temps, et non l’argent”.

Pour 5 000 yuans par an, ces jeunes gens disposent ainsi d’une parcelle en location, mais aussi des graines, des engrais, etc. Le gérant de la ferme cultive les légumes à leur place, et peut même proposer de “cueillir et de livrer la récolte lorsque le locataire est trop pris par son métier et n’a pas le temps de s’en occuper”.

Au final, Yang Zhang peut se contenter de choisir les fruits et légumes de saison qu’il désire pour pouvoir ensuite récolter “concombres, tomates, poivrons, haricots, aubergines et autres” à intervalles réguliers, de mars à décembre, sans interruption. Son lopin comportant une serre de 20 m², c’est l’assurance pour lui d’avoir des légumes frais même en hiver. Quant aux 20 m² extérieurs, il peut librement y faire du camping.

Pour un prix tout à fait raisonnable, la nouvelle génération issue de la classe moyenne des grandes villes comme Pékin, Shanghai ou Canton est désormais libre de se détendre dans un cadre idyllique.

Les noms de toutes les personnes mentionnées dans l’article sont des pseudonymes.

L’article original a été publié sur le compte Weixin (ou WeChat) du studio Ranciyuan.

Source de l’article
Weixin (WeChat) (Shenzhen)

Weixin est le moyen de communication le plus populaire en Chine. Le groupe Tencent auquel l’application de messagerie par texte, son ou image appartient fait état de plus d’un milliard de comptes. Mais Weixin est aussi une plateforme de blogs qui donne un espace de relative liberté aux Chinois, dans un environnement médiatique très contrôlé. On y trouve parfois des reportages, des témoignages, des opinions, qui sont signalés par les internautes, faisant de cette plateforme un média vivant, qui n’échappe cependant plus à la censure.
Weixin offre par ailleurs tant de services différents dans le domaine du commerce électronique que c’est aussi devenu un moyen de paiement des plus courants en Chine. L’application a aussi été lancée à l’étranger sous le nom de WeChat et offre des services en plusieurs langues étrangères, dont le français et l’anglais.